ID: 1072743521

View in Genome Browser
Species Human (GRCh38)
Location 10:97924335-97924357
Sequence CTGGGCTGGACAGGAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072743507_1072743521 17 Left 1072743507 10:97924295-97924317 CCCGAATGTTCGTAGTTTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1072743521 10:97924335-97924357 CTGGGCTGGACAGGAAACACAGG No data
1072743505_1072743521 18 Left 1072743505 10:97924294-97924316 CCCCGAATGTTCGTAGTTTAGGG 0: 1
1: 0
2: 1
3: 1
4: 23
Right 1072743521 10:97924335-97924357 CTGGGCTGGACAGGAAACACAGG No data
1072743514_1072743521 -9 Left 1072743514 10:97924321-97924343 CCTCGTTCTACCCCCTGGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 208
Right 1072743521 10:97924335-97924357 CTGGGCTGGACAGGAAACACAGG No data
1072743509_1072743521 16 Left 1072743509 10:97924296-97924318 CCGAATGTTCGTAGTTTAGGGGG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1072743521 10:97924335-97924357 CTGGGCTGGACAGGAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072743521 Original CRISPR CTGGGCTGGACAGGAAACAC AGG Intronic
No off target data available for this crispr