ID: 1072743766

View in Genome Browser
Species Human (GRCh38)
Location 10:97926047-97926069
Sequence GGCTTCTCCGGACAGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072743766_1072743781 28 Left 1072743766 10:97926047-97926069 CCTGCCTGCTGTCCGGAGAAGCC No data
Right 1072743781 10:97926098-97926120 CGCTGAGTGGAGGCAGACCCAGG No data
1072743766_1072743777 18 Left 1072743766 10:97926047-97926069 CCTGCCTGCTGTCCGGAGAAGCC No data
Right 1072743777 10:97926088-97926110 AAGTCCCTTCCGCTGAGTGGAGG No data
1072743766_1072743776 15 Left 1072743766 10:97926047-97926069 CCTGCCTGCTGTCCGGAGAAGCC No data
Right 1072743776 10:97926085-97926107 GAAAAGTCCCTTCCGCTGAGTGG No data
1072743766_1072743772 -7 Left 1072743766 10:97926047-97926069 CCTGCCTGCTGTCCGGAGAAGCC No data
Right 1072743772 10:97926063-97926085 AGAAGCCTGACCCAGGGAGGAGG No data
1072743766_1072743771 -10 Left 1072743766 10:97926047-97926069 CCTGCCTGCTGTCCGGAGAAGCC No data
Right 1072743771 10:97926060-97926082 CGGAGAAGCCTGACCCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072743766 Original CRISPR GGCTTCTCCGGACAGCAGGC AGG (reversed) Intronic