ID: 1072744662

View in Genome Browser
Species Human (GRCh38)
Location 10:97931765-97931787
Sequence GCACTCCCGCCCGCATGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072744662_1072744667 5 Left 1072744662 10:97931765-97931787 CCAGCTCATGCGGGCGGGAGTGC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1072744667 10:97931793-97931815 GCTATTCAGTGAAGCAGCTGGGG No data
1072744662_1072744666 4 Left 1072744662 10:97931765-97931787 CCAGCTCATGCGGGCGGGAGTGC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1072744666 10:97931792-97931814 GGCTATTCAGTGAAGCAGCTGGG No data
1072744662_1072744665 3 Left 1072744662 10:97931765-97931787 CCAGCTCATGCGGGCGGGAGTGC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1072744665 10:97931791-97931813 GGGCTATTCAGTGAAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072744662 Original CRISPR GCACTCCCGCCCGCATGAGC TGG (reversed) Intronic
901352667 1:8611467-8611489 GCACTCCAGCCTGCATGACAGGG + Intronic
901356003 1:8649693-8649715 GCACTCCAGCCTGCATGACAGGG + Intronic
902978040 1:20103463-20103485 GCAGTCCCGCCAGCCTGAGCTGG + Intergenic
917315460 1:173720085-173720107 GCACTCCAGCCCGGATGACAGGG + Intronic
917556490 1:176095642-176095664 GCACTCCCGCCTGGGTGAGAGGG + Intronic
923036260 1:230287128-230287150 CCCCTCCAGCCCTCATGAGCCGG - Intergenic
1066657905 10:37712313-37712335 TCACCCCAGCCCGCAGGAGCTGG + Intergenic
1067112556 10:43410393-43410415 GCACTCCCGCCTGAATGACAGGG - Intergenic
1072440426 10:95449269-95449291 GCACTCCAGCCTGGATGAGGGGG - Intronic
1072744662 10:97931765-97931787 GCACTCCCGCCCGCATGAGCTGG - Intronic
1075545445 10:123351461-123351483 TCTCTTCAGCCCGCATGAGCTGG + Intergenic
1079882469 11:25944404-25944426 GGACTCCTGCCCTCCTGAGCGGG - Intergenic
1083419926 11:62546840-62546862 GCAGACCCGCCCGCCCGAGCCGG - Intronic
1083476652 11:62919754-62919776 GCGCTGCCGCCTCCATGAGCAGG - Intronic
1083808292 11:65087961-65087983 GCAGCCCCGCCCGCTGGAGCAGG - Exonic
1083867402 11:65463950-65463972 GCACTCCAGCCTGCATGACAAGG + Intergenic
1084061427 11:66677865-66677887 GCACTCGCGCGTGCGTGAGCTGG - Intronic
1085206626 11:74737327-74737349 GCACTCCAGCCCGGATGACAGGG + Intergenic
1086205869 11:84257719-84257741 GCACTCCAGCCTGCATGACAAGG - Intronic
1086488602 11:87335449-87335471 GCACTCCAGCCTGCATGACAGGG - Intergenic
1089296235 11:117470049-117470071 CCACTCCCACCCTCCTGAGCTGG + Intronic
1094238078 12:28190833-28190855 GCACTCCCACCCCCGGGAGCTGG - Intronic
1095040105 12:37432113-37432135 GCATTCCCACCTGCATGATCTGG + Intergenic
1096182529 12:49558574-49558596 CCACTCCAGCCCCCTTGAGCTGG - Intronic
1096773967 12:53953080-53953102 CCCCTCCCGCCCCCAGGAGCCGG - Intergenic
1115245107 14:31286945-31286967 GCACTCCCTCCCACATGGGGAGG - Intergenic
1115261885 14:31462685-31462707 GCACTCCAGCCTGCATGACAGGG + Intergenic
1115775302 14:36708470-36708492 GCACTCCAGCCTGCATGACAGGG - Intronic
1118866892 14:69711313-69711335 GCACTCAGGCCCACAGGAGCTGG - Exonic
1119473153 14:74911678-74911700 GCACTCCCTCCCACAAAAGCTGG - Intronic
1127933129 15:63610833-63610855 GCCCTCTCTCCCACATGAGCTGG - Intronic
1129311999 15:74719338-74719360 GCACTCCAGCCTGGATGACCTGG + Intergenic
1133115052 16:3573627-3573649 CCACTCCCGCCCCCAGCAGCAGG - Intronic
1135045432 16:19151173-19151195 GCACTCCAGCCCGGATGACAGGG - Intronic
1140525078 16:75616041-75616063 GCACTCCAGCCTGGATGACCCGG - Intronic
1140651411 16:77092516-77092538 GCTCTCCCCGCCGCATCAGCTGG - Intergenic
1142119048 16:88376968-88376990 GCCCTCCCGGCGGCATGAGCGGG - Intergenic
1143641912 17:8203809-8203831 GCACTCCAGCCTGCATGACAGGG + Intergenic
1147965406 17:44191998-44192020 TCACTCCCCCCCGCATGCCCAGG - Exonic
1148075348 17:44932461-44932483 GCACCCCAGCCCGTAAGAGCAGG - Intronic
1158099931 18:53819353-53819375 GCTCTCCCACCCCCATAAGCTGG + Intergenic
1161428538 19:4217563-4217585 GGACTCCCGCCTGCGGGAGCTGG + Exonic
1161646630 19:5456938-5456960 GCTCTCCCGCCCGCAGAAACGGG - Intergenic
1166355611 19:42225623-42225645 GCACTCACGCCGGCAAAAGCGGG + Exonic
1168609342 19:57786665-57786687 GCTCTCCCGACCGCATCAACCGG - Intronic
925368100 2:3324760-3324782 GCACTCCCCCCGGCGTGACCGGG - Intronic
932635611 2:73385751-73385773 GCAGTGCCGCCCGCCTGGGCGGG - Exonic
938559821 2:132462075-132462097 GGAGTCCCTCCCTCATGAGCAGG - Intronic
948859936 2:240747899-240747921 GCACTGACTCCTGCATGAGCAGG - Intronic
1171390411 20:24798208-24798230 ACACTCCGGCCCACATGAGATGG + Intergenic
1173555614 20:43963379-43963401 GCACTGCCTGCCGCAGGAGCTGG - Intronic
1175991343 20:62791311-62791333 GCACTCTCGACCGCCTGAGGGGG - Intergenic
1180258375 21:46649733-46649755 GCACGCCCGCCCTCACCAGCAGG - Exonic
1184688898 22:46108628-46108650 GCACTCCTGCCAGAATGGGCTGG + Intronic
1185056216 22:48579702-48579724 GCACTCCAGCACAGATGAGCAGG + Intronic
949366073 3:3282239-3282261 GCACTCCAGCCTGCATGATCTGG + Intergenic
950247145 3:11431364-11431386 GCACTCCAGCCTGCAAGGGCGGG + Intronic
950742455 3:15062114-15062136 GCACTCCCTCCCGGATGGGGCGG - Intronic
953724957 3:45389515-45389537 GCACTCCCTCCTGCCTGTGCAGG + Intronic
956837733 3:73109553-73109575 GCACTCCAGCCTGCATGACAGGG - Intergenic
960026789 3:113019460-113019482 CCACCCCCGCCCACATGCGCCGG + Intronic
960105960 3:113797285-113797307 GCACTCCAGCCTGCATGATGGGG - Intronic
962339196 3:134567726-134567748 GAACTCCCACCCGGAAGAGCAGG - Intronic
962875629 3:139534033-139534055 GAAGTCCCCCCAGCATGAGCAGG - Intronic
963789644 3:149570531-149570553 GCACTCCAGCCCGGATGACAGGG + Intronic
969351842 4:6602702-6602724 GCACTCCAGCCTGCATGACAGGG - Intronic
970593185 4:17577174-17577196 TCGCCCCCGCCCGCATGCGCGGG + Exonic
971406037 4:26321281-26321303 GCACTCACGCCCGCACCCGCCGG - Intronic
972971526 4:44582668-44582690 GCAGGCACGCCTGCATGAGCTGG - Intergenic
985642136 5:1068662-1068684 GTCCTCCCGTCCGCAAGAGCGGG + Intronic
997453943 5:134004356-134004378 GCACTTCCGCCCGCAAGCCCGGG + Intronic
997560024 5:134838381-134838403 GCACTCCCGGCCGGATGCGGTGG + Intronic
997852613 5:137346253-137346275 CCCCTCCTGCCCTCATGAGCTGG + Intronic
1001265079 5:170268398-170268420 GCCCTCCCGCCCCCACCAGCCGG - Exonic
1002924360 6:1596203-1596225 GCTCTCTCTCCCTCATGAGCTGG + Intergenic
1002929540 6:1624020-1624042 GCTGTCCCGGCCGCAAGAGCGGG - Exonic
1004201751 6:13555106-13555128 GAACTCCCGCCTGGAGGAGCTGG - Intergenic
1019174516 6:170153480-170153502 CCAGTCCCACCTGCATGAGCCGG + Intergenic
1019751489 7:2733420-2733442 GCACGCCCGCCCGAAGAAGCTGG - Intronic
1022565317 7:31394133-31394155 GCACTCCAGCCTGCATGACAGGG - Intergenic
1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG + Intronic
1049090875 8:140512349-140512371 GCCCTCCCGCCCGCCACAGCTGG + Intronic
1056569169 9:87800728-87800750 GCACTCCCGACAGCAGGCGCTGG - Intergenic
1058904136 9:109467738-109467760 GCACCCACGCCAGCACGAGCAGG - Intronic
1061863476 9:133479375-133479397 GCAGTCACGCCTGCAAGAGCCGG - Intergenic
1062071992 9:134560837-134560859 GAGCTCCCGGCCGCCTGAGCAGG - Intergenic
1062508763 9:136893141-136893163 GCTCTGCCGCCCACAGGAGCAGG + Intronic
1185870835 X:3663592-3663614 GCACTCCAGCCTGGATGAGACGG + Intronic
1188184727 X:27100079-27100101 GCACTCCAGCCTGCATGACGGGG - Intergenic
1192363674 X:70454517-70454539 GCACTGCAGCCCACATCAGCAGG - Intronic