ID: 1072749406

View in Genome Browser
Species Human (GRCh38)
Location 10:97966530-97966552
Sequence CCCATGTAACATACTAATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072749406 Original CRISPR CCCATGTAACATACTAATGT AGG (reversed) Intronic
909620070 1:77657875-77657897 ACCACTTAACATACTAGTGTAGG + Intronic
911028662 1:93462387-93462409 CAAATGTACCATACTAATGTAGG - Intronic
911426591 1:97722441-97722463 CAAATGTACCATACTAATGTAGG + Intronic
913257675 1:116969297-116969319 TCCATGCAACATAATAAAGTTGG - Intronic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
918642633 1:186861710-186861732 CCTATGTGAAATTCTAATGTTGG + Intronic
919615416 1:199802165-199802187 CCTACAAAACATACTAATGTGGG + Intergenic
919688981 1:200511612-200511634 CTCATGTCACATTTTAATGTGGG - Intergenic
919903660 1:202062384-202062406 CACATGTACTATACTAATGTGGG + Intergenic
920217486 1:204371303-204371325 CCCATCTCAGATACTAATTTTGG + Intronic
920598320 1:207295899-207295921 CACGTATTACATACTAATGTGGG - Intergenic
1063091796 10:2872151-2872173 TCCATGTAACAGATTAATGTGGG - Intergenic
1065504136 10:26412183-26412205 ACAATGTAACACTCTAATGTAGG + Intergenic
1070815984 10:79323599-79323621 CCCATGTCACAGCCCAATGTGGG + Intergenic
1071270704 10:84004367-84004389 TCCATGTAATATCCTGATGTTGG - Intergenic
1072749406 10:97966530-97966552 CCCATGTAACATACTAATGTAGG - Intronic
1073499452 10:103922622-103922644 CACATCTAACATACTACGGTGGG + Intergenic
1077528355 11:3082658-3082680 AACATGTAGCAAACTAATGTAGG - Intergenic
1078029105 11:7730821-7730843 CCCATGTAAAAGAATAAGGTTGG - Intergenic
1080565996 11:33510076-33510098 CCCATGCCACACACTAATGAAGG - Intergenic
1086050598 11:82585236-82585258 CTCATGTAATATACCAATTTTGG + Intergenic
1086267498 11:85019001-85019023 CCCACACAGCATACTAATGTAGG + Intronic
1088148420 11:106713805-106713827 CCAAAGAAATATACTAATGTTGG - Intronic
1088592354 11:111414680-111414702 CTCATTAAACATACTGATGTGGG - Intronic
1089936681 11:122371429-122371451 CCCAAGTAAAATAATAGTGTAGG - Intergenic
1093357453 12:18184904-18184926 CACACGTATCACACTAATGTAGG - Intronic
1097488280 12:60233557-60233579 AAAATGTAACATAGTAATGTGGG + Intergenic
1098295615 12:69001164-69001186 CCCATGTAACATCCTCCTCTTGG + Intergenic
1101316599 12:103634698-103634720 CTCATGTAACAGTCCAATGTGGG + Intronic
1102946299 12:116991902-116991924 TGCCTGTAACATGCTAATGTGGG - Intronic
1105358936 13:19688206-19688228 TCCCTGTAACACACTTATGTTGG + Intronic
1105994554 13:25657663-25657685 TCTATGTAACACACAAATGTTGG + Intronic
1107574563 13:41704111-41704133 CCTATACAACATACAAATGTGGG - Intronic
1110315207 13:74098910-74098932 GACATGTAACATACTAGCGTGGG - Intronic
1114336833 14:21699045-21699067 CCCCAGTAACATTCTAATCTTGG + Intergenic
1114764396 14:25354332-25354354 CCCAAGTAACATTCTAATCTCGG - Intergenic
1120232534 14:81855852-81855874 CCCATGGAACATCCTCCTGTGGG + Intergenic
1126340885 15:47640031-47640053 CAAATGTATCATAGTAATGTAGG + Intronic
1129512003 15:76131073-76131095 AGCATGTAAAATACTAATTTGGG + Intronic
1129679344 15:77649431-77649453 CCCATATTACAGACTCATGTGGG - Intronic
1140619123 16:76706368-76706390 CCCATGTAACATCCTTGAGTAGG - Intergenic
1140885608 16:79240003-79240025 CCCATTTAAAATAATAATTTGGG - Intergenic
1141919029 16:87122495-87122517 CCCATTAACCATTCTAATGTGGG + Intronic
1147060512 17:37873566-37873588 GACAAGTAACATTCTAATGTAGG + Intergenic
1148761397 17:50003545-50003567 CAAATGTATCACACTAATGTAGG + Intergenic
1152761453 17:82109419-82109441 CCCATGTAAAACAAGAATGTAGG + Intronic
1156074207 18:33253410-33253432 CCCATGAAACATCCTCATATTGG - Intronic
1163464324 19:17457727-17457749 CCCAGATAACATACTAGTCTGGG + Intronic
928386371 2:30871928-30871950 ACCATTTGACATCCTAATGTTGG - Intergenic
932510728 2:72286680-72286702 CACATGTAACATACCACTCTGGG + Intronic
932917108 2:75871590-75871612 GACATGTACCATAGTAATGTAGG + Intergenic
934063024 2:88313874-88313896 CAAATGTACCATACTAATGTAGG + Intergenic
936738990 2:115481211-115481233 CCCTTTCAACATACTACTGTGGG + Intronic
937071995 2:119071485-119071507 CCCCTGGAACATACTTATTTGGG - Intergenic
938098824 2:128483599-128483621 CACATGTAAAAGAATAATGTTGG + Intergenic
939546754 2:143564226-143564248 CCCATGTAACATAATCATGAAGG + Intronic
941270766 2:163424972-163424994 CAAATGTACCATACTAATGTAGG + Intergenic
942586885 2:177489961-177489983 CCCATGTTATTTACTAATGCAGG - Intronic
943765728 2:191659654-191659676 CAAATGTTTCATACTAATGTAGG + Intergenic
948512909 2:238483652-238483674 CGCAGGTAACATATTTATGTTGG - Intergenic
1173431653 20:42992909-42992931 ACCATGTAACATATTAAAGGTGG - Intronic
1178036865 21:28594382-28594404 CAAATGTACCAAACTAATGTAGG + Intergenic
1178798183 21:35765164-35765186 CCCATGTCACATGCTCATGCTGG + Intronic
1180737788 22:18031520-18031542 TCTAAGTAAAATACTAATGTTGG - Intergenic
953424582 3:42783317-42783339 CACATTTAACATACAAAAGTAGG + Intronic
953516736 3:43600475-43600497 CCCTAGTAACATTCTAATCTTGG + Exonic
955930513 3:64051822-64051844 CATATGTACCATACTAATGTAGG + Intergenic
956925394 3:73981665-73981687 CCCATGTCACATACCCATGATGG + Intergenic
958875911 3:99617021-99617043 CCCATGTAATATCCTGATGATGG + Intergenic
959478834 3:106846451-106846473 ACCATGTAAAGTACCAATGTAGG - Intergenic
959526319 3:107381411-107381433 CCCCTCTAACATTCTTATGTAGG - Intergenic
962293236 3:134154911-134154933 CTCATTGAACATACAAATGTAGG - Intronic
966765342 3:183456928-183456950 CCCATGTACCATTCTGGTGTGGG - Intergenic
967231100 3:187338189-187338211 CCCATGTAATCTACTCATGGGGG + Intergenic
969047543 4:4347611-4347633 GCCATGTCATATACTATTGTTGG + Intergenic
969895161 4:10296868-10296890 GCCATGTGACATGCTCATGTTGG - Intergenic
969932782 4:10647791-10647813 CCCATGAAAGACACTATTGTAGG + Intronic
972023449 4:34344735-34344757 CCCAAGAAACATACATATGTGGG - Intergenic
972029851 4:34440895-34440917 CCCATGTTAGATACTAACATGGG - Intergenic
973318791 4:48788806-48788828 CCTAGGTAAAATACTAGTGTTGG - Intergenic
978859855 4:113435269-113435291 CACATGTAGCAAACCAATGTGGG - Intergenic
979991140 4:127377128-127377150 CCCATGTAAATTACTAACATTGG - Intergenic
980436402 4:132780144-132780166 CCTATCTAAGATACCAATGTAGG + Intergenic
980608871 4:135130670-135130692 ACCATGTAATATATTAATATTGG - Intergenic
982873507 4:160614186-160614208 CCCAGCTAACATATTAATTTTGG + Intergenic
989182072 5:38588145-38588167 TCCATGTCACATGTTAATGTTGG - Intronic
992388789 5:76311764-76311786 ACCATCTAACATACTGGTGTGGG + Intronic
994961931 5:106616171-106616193 CAAATGTACCATACTAATGTCGG + Intergenic
995305976 5:110650855-110650877 CAAATGTATCATACTAATGTAGG + Intronic
995574191 5:113512680-113512702 CCCATGTCATATTCCAATGTGGG + Intergenic
996895416 5:128475288-128475310 CCCATATAACTTACTAGTATTGG + Intronic
997024813 5:130046230-130046252 GCCATGTAGCATACAAATGAAGG + Intronic
1008043850 6:46831860-46831882 CCTCTGTAACATACAAATCTAGG - Intronic
1008435539 6:51471664-51471686 CCCATGTAACATACTCAAATGGG + Intergenic
1010867260 6:80993482-80993504 CCCATGAAACATTTTGATGTAGG - Intergenic
1011233122 6:85186410-85186432 CCCAGGTAACACACTAACCTGGG + Intergenic
1012456648 6:99414003-99414025 GCCATGTATCATTCTATTGTAGG - Intronic
1012560382 6:100573056-100573078 CCAAAGTAACATAATATTGTAGG + Intronic
1012909294 6:105101533-105101555 CCCATGTATGATATTAATGTAGG - Intronic
1015175811 6:130307330-130307352 CCCATGCAAAATAAAAATGTGGG - Intronic
1018130036 6:160721137-160721159 ATCCTTTAACATACTAATGTAGG + Intronic
1021054199 7:16026879-16026901 CCAATGACACATACTCATGTGGG - Intergenic
1024029148 7:45442153-45442175 CCCATGCAAAATAAAAATGTGGG - Intergenic
1024171671 7:46794295-46794317 CAAATGTAACATACTAGTATAGG - Intergenic
1024332818 7:48173293-48173315 TGCATGTAACATACTAATGTAGG - Intronic
1025271086 7:57517750-57517772 CCCATGTTAGATACTAACATGGG + Intergenic
1030507316 7:110441440-110441462 CCCTTGTAAAATAGAAATGTTGG - Intergenic
1031739933 7:125417337-125417359 CCCATGTAACAAACTTATACAGG - Intergenic
1032511099 7:132473011-132473033 GCCACGTAACATCCTGATGTGGG - Intronic
1032647979 7:133846952-133846974 CCCATGTAACTTTCTAAGGAAGG - Intronic
1037093454 8:14952377-14952399 GCCATGTAACAGACCTATGTGGG - Intronic
1037864798 8:22435039-22435061 CACCTGTAATATAATAATGTTGG + Intergenic
1039191401 8:34980358-34980380 CCCATGTAACATACAAGCTTAGG - Intergenic
1044028608 8:87206134-87206156 CACAGGTAATAGACTAATGTGGG + Exonic
1053653745 9:40195078-40195100 CCTCTGTAACATACAAATCTAGG + Intergenic
1053904129 9:42824240-42824262 CCTCTGTAACATACAAATCTAGG + Intergenic
1054530855 9:66181273-66181295 CCTCTGTAACATACAAATCTAGG - Intergenic
1189370541 X:40425119-40425141 CACATGTAACAGAATAAAGTTGG - Intergenic
1191719633 X:64218666-64218688 ACCAAGTAATATAATAATGTTGG - Intergenic
1192907811 X:75570040-75570062 CCAATGTATGATACTTATGTGGG + Intergenic
1199627747 X:149756845-149756867 CAAATGTACCATACTCATGTAGG + Intergenic