ID: 1072753575

View in Genome Browser
Species Human (GRCh38)
Location 10:98001870-98001892
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072753570_1072753575 -6 Left 1072753570 10:98001853-98001875 CCACCTGCTCACCAGGTCAGTAG 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG No data
1072753572_1072753575 -9 Left 1072753572 10:98001856-98001878 CCTGCTCACCAGGTCAGTAGGAC 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr