ID: 1072753585

View in Genome Browser
Species Human (GRCh38)
Location 10:98001939-98001961
Sequence AGCATCACTGCTGCTCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072753585_1072753595 27 Left 1072753585 10:98001939-98001961 CCCCCTGGAGCAGCAGTGATGCT No data
Right 1072753595 10:98001989-98002011 GAGCAGGGCAAGAATGAGGAAGG No data
1072753585_1072753594 23 Left 1072753585 10:98001939-98001961 CCCCCTGGAGCAGCAGTGATGCT No data
Right 1072753594 10:98001985-98002007 CAAAGAGCAGGGCAAGAATGAGG No data
1072753585_1072753591 11 Left 1072753585 10:98001939-98001961 CCCCCTGGAGCAGCAGTGATGCT No data
Right 1072753591 10:98001973-98001995 TTGCGTATATTCCAAAGAGCAGG No data
1072753585_1072753592 12 Left 1072753585 10:98001939-98001961 CCCCCTGGAGCAGCAGTGATGCT No data
Right 1072753592 10:98001974-98001996 TGCGTATATTCCAAAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072753585 Original CRISPR AGCATCACTGCTGCTCCAGG GGG (reversed) Intronic
No off target data available for this crispr