ID: 1072758021

View in Genome Browser
Species Human (GRCh38)
Location 10:98033438-98033460
Sequence CTCCAAATGCAGTCACACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072758021_1072758029 23 Left 1072758021 10:98033438-98033460 CCTTAGTGTGACTGCATTTGGAG No data
Right 1072758029 10:98033484-98033506 AAGGCAAAATGAGATCATAAGGG No data
1072758021_1072758026 4 Left 1072758021 10:98033438-98033460 CCTTAGTGTGACTGCATTTGGAG No data
Right 1072758026 10:98033465-98033487 GGCCTTTAAAGGGGCAATTAAGG No data
1072758021_1072758024 -6 Left 1072758021 10:98033438-98033460 CCTTAGTGTGACTGCATTTGGAG No data
Right 1072758024 10:98033455-98033477 TTGGAGATAAGGCCTTTAAAGGG No data
1072758021_1072758025 -5 Left 1072758021 10:98033438-98033460 CCTTAGTGTGACTGCATTTGGAG No data
Right 1072758025 10:98033456-98033478 TGGAGATAAGGCCTTTAAAGGGG 0: 28
1: 157
2: 567
3: 1119
4: 1588
1072758021_1072758028 22 Left 1072758021 10:98033438-98033460 CCTTAGTGTGACTGCATTTGGAG No data
Right 1072758028 10:98033483-98033505 TAAGGCAAAATGAGATCATAAGG No data
1072758021_1072758030 26 Left 1072758021 10:98033438-98033460 CCTTAGTGTGACTGCATTTGGAG No data
Right 1072758030 10:98033487-98033509 GCAAAATGAGATCATAAGGGTGG No data
1072758021_1072758023 -7 Left 1072758021 10:98033438-98033460 CCTTAGTGTGACTGCATTTGGAG No data
Right 1072758023 10:98033454-98033476 TTTGGAGATAAGGCCTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072758021 Original CRISPR CTCCAAATGCAGTCACACTA AGG (reversed) Intergenic
No off target data available for this crispr