ID: 1072759438

View in Genome Browser
Species Human (GRCh38)
Location 10:98043809-98043831
Sequence AAATAGAGACTATGCTAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072759438_1072759443 5 Left 1072759438 10:98043809-98043831 CCCTGCTAGCATAGTCTCTATTT No data
Right 1072759443 10:98043837-98043859 ATGAGGAAAAAAAAAATAGGAGG No data
1072759438_1072759442 2 Left 1072759438 10:98043809-98043831 CCCTGCTAGCATAGTCTCTATTT No data
Right 1072759442 10:98043834-98043856 CCTATGAGGAAAAAAAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072759438 Original CRISPR AAATAGAGACTATGCTAGCA GGG (reversed) Intergenic
No off target data available for this crispr