ID: 1072767219

View in Genome Browser
Species Human (GRCh38)
Location 10:98105256-98105278
Sequence GTCCTTAAGGGACATTCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072767219_1072767224 27 Left 1072767219 10:98105256-98105278 CCATTAGAATGTCCCTTAAGGAC No data
Right 1072767224 10:98105306-98105328 CAGATTTTTATGCTGTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072767219 Original CRISPR GTCCTTAAGGGACATTCTAA TGG (reversed) Intergenic
No off target data available for this crispr