ID: 1072768328

View in Genome Browser
Species Human (GRCh38)
Location 10:98114809-98114831
Sequence CCTCTTCAGGGCTTCTGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072768328_1072768337 19 Left 1072768328 10:98114809-98114831 CCATTACAGAAGCCCTGAAGAGG No data
Right 1072768337 10:98114851-98114873 CTGGGTCCAAGAAGTCTTCCTGG No data
1072768328_1072768333 0 Left 1072768328 10:98114809-98114831 CCATTACAGAAGCCCTGAAGAGG No data
Right 1072768333 10:98114832-98114854 AGTTCCCAGCTCAAACTGGCTGG No data
1072768328_1072768334 1 Left 1072768328 10:98114809-98114831 CCATTACAGAAGCCCTGAAGAGG No data
Right 1072768334 10:98114833-98114855 GTTCCCAGCTCAAACTGGCTGGG No data
1072768328_1072768332 -4 Left 1072768328 10:98114809-98114831 CCATTACAGAAGCCCTGAAGAGG No data
Right 1072768332 10:98114828-98114850 GAGGAGTTCCCAGCTCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072768328 Original CRISPR CCTCTTCAGGGCTTCTGTAA TGG (reversed) Intergenic
No off target data available for this crispr