ID: 1072768330

View in Genome Browser
Species Human (GRCh38)
Location 10:98114821-98114843
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072768330_1072768340 22 Left 1072768330 10:98114821-98114843 CCCTGAAGAGGAGTTCCCAGCTC No data
Right 1072768340 10:98114866-98114888 CTTCCTGGAAGAAGTGATGGAGG No data
1072768330_1072768339 19 Left 1072768330 10:98114821-98114843 CCCTGAAGAGGAGTTCCCAGCTC No data
Right 1072768339 10:98114863-98114885 AGTCTTCCTGGAAGAAGTGATGG No data
1072768330_1072768337 7 Left 1072768330 10:98114821-98114843 CCCTGAAGAGGAGTTCCCAGCTC No data
Right 1072768337 10:98114851-98114873 CTGGGTCCAAGAAGTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072768330 Original CRISPR GAGCTGGGAACTCCTCTTCA GGG (reversed) Intergenic