ID: 1072768331

View in Genome Browser
Species Human (GRCh38)
Location 10:98114822-98114844
Sequence TGAGCTGGGAACTCCTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072768331_1072768340 21 Left 1072768331 10:98114822-98114844 CCTGAAGAGGAGTTCCCAGCTCA No data
Right 1072768340 10:98114866-98114888 CTTCCTGGAAGAAGTGATGGAGG No data
1072768331_1072768339 18 Left 1072768331 10:98114822-98114844 CCTGAAGAGGAGTTCCCAGCTCA No data
Right 1072768339 10:98114863-98114885 AGTCTTCCTGGAAGAAGTGATGG No data
1072768331_1072768337 6 Left 1072768331 10:98114822-98114844 CCTGAAGAGGAGTTCCCAGCTCA No data
Right 1072768337 10:98114851-98114873 CTGGGTCCAAGAAGTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072768331 Original CRISPR TGAGCTGGGAACTCCTCTTC AGG (reversed) Intergenic