ID: 1072768332 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:98114828-98114850 |
Sequence | GAGGAGTTCCCAGCTCAAAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1072768328_1072768332 | -4 | Left | 1072768328 | 10:98114809-98114831 | CCATTACAGAAGCCCTGAAGAGG | No data | ||
Right | 1072768332 | 10:98114828-98114850 | GAGGAGTTCCCAGCTCAAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1072768332 | Original CRISPR | GAGGAGTTCCCAGCTCAAAC TGG | Intergenic | ||