ID: 1072768332

View in Genome Browser
Species Human (GRCh38)
Location 10:98114828-98114850
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072768328_1072768332 -4 Left 1072768328 10:98114809-98114831 CCATTACAGAAGCCCTGAAGAGG No data
Right 1072768332 10:98114828-98114850 GAGGAGTTCCCAGCTCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072768332 Original CRISPR GAGGAGTTCCCAGCTCAAAC TGG Intergenic