ID: 1072768335

View in Genome Browser
Species Human (GRCh38)
Location 10:98114836-98114858
Sequence GGACCCAGCCAGTTTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072768335_1072768342 22 Left 1072768335 10:98114836-98114858 CCCAGCTCAAACTGGCTGGGTCC No data
Right 1072768342 10:98114881-98114903 GATGGAGGAACAGTATTCTAAGG No data
1072768335_1072768343 23 Left 1072768335 10:98114836-98114858 CCCAGCTCAAACTGGCTGGGTCC No data
Right 1072768343 10:98114882-98114904 ATGGAGGAACAGTATTCTAAGGG No data
1072768335_1072768340 7 Left 1072768335 10:98114836-98114858 CCCAGCTCAAACTGGCTGGGTCC No data
Right 1072768340 10:98114866-98114888 CTTCCTGGAAGAAGTGATGGAGG No data
1072768335_1072768339 4 Left 1072768335 10:98114836-98114858 CCCAGCTCAAACTGGCTGGGTCC No data
Right 1072768339 10:98114863-98114885 AGTCTTCCTGGAAGAAGTGATGG No data
1072768335_1072768337 -8 Left 1072768335 10:98114836-98114858 CCCAGCTCAAACTGGCTGGGTCC No data
Right 1072768337 10:98114851-98114873 CTGGGTCCAAGAAGTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072768335 Original CRISPR GGACCCAGCCAGTTTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr