ID: 1072768337

View in Genome Browser
Species Human (GRCh38)
Location 10:98114851-98114873
Sequence CTGGGTCCAAGAAGTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072768331_1072768337 6 Left 1072768331 10:98114822-98114844 CCTGAAGAGGAGTTCCCAGCTCA No data
Right 1072768337 10:98114851-98114873 CTGGGTCCAAGAAGTCTTCCTGG No data
1072768335_1072768337 -8 Left 1072768335 10:98114836-98114858 CCCAGCTCAAACTGGCTGGGTCC No data
Right 1072768337 10:98114851-98114873 CTGGGTCCAAGAAGTCTTCCTGG No data
1072768330_1072768337 7 Left 1072768330 10:98114821-98114843 CCCTGAAGAGGAGTTCCCAGCTC No data
Right 1072768337 10:98114851-98114873 CTGGGTCCAAGAAGTCTTCCTGG No data
1072768328_1072768337 19 Left 1072768328 10:98114809-98114831 CCATTACAGAAGCCCTGAAGAGG No data
Right 1072768337 10:98114851-98114873 CTGGGTCCAAGAAGTCTTCCTGG No data
1072768336_1072768337 -9 Left 1072768336 10:98114837-98114859 CCAGCTCAAACTGGCTGGGTCCA No data
Right 1072768337 10:98114851-98114873 CTGGGTCCAAGAAGTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072768337 Original CRISPR CTGGGTCCAAGAAGTCTTCC TGG Intergenic
No off target data available for this crispr