ID: 1072768339

View in Genome Browser
Species Human (GRCh38)
Location 10:98114863-98114885
Sequence AGTCTTCCTGGAAGAAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072768336_1072768339 3 Left 1072768336 10:98114837-98114859 CCAGCTCAAACTGGCTGGGTCCA No data
Right 1072768339 10:98114863-98114885 AGTCTTCCTGGAAGAAGTGATGG No data
1072768330_1072768339 19 Left 1072768330 10:98114821-98114843 CCCTGAAGAGGAGTTCCCAGCTC No data
Right 1072768339 10:98114863-98114885 AGTCTTCCTGGAAGAAGTGATGG No data
1072768335_1072768339 4 Left 1072768335 10:98114836-98114858 CCCAGCTCAAACTGGCTGGGTCC No data
Right 1072768339 10:98114863-98114885 AGTCTTCCTGGAAGAAGTGATGG No data
1072768331_1072768339 18 Left 1072768331 10:98114822-98114844 CCTGAAGAGGAGTTCCCAGCTCA No data
Right 1072768339 10:98114863-98114885 AGTCTTCCTGGAAGAAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072768339 Original CRISPR AGTCTTCCTGGAAGAAGTGA TGG Intergenic