ID: 1072768341

View in Genome Browser
Species Human (GRCh38)
Location 10:98114869-98114891
Sequence GTTCCTCCATCACTTCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072768341_1072768343 -10 Left 1072768341 10:98114869-98114891 CCTGGAAGAAGTGATGGAGGAAC No data
Right 1072768343 10:98114882-98114904 ATGGAGGAACAGTATTCTAAGGG No data
1072768341_1072768346 21 Left 1072768341 10:98114869-98114891 CCTGGAAGAAGTGATGGAGGAAC No data
Right 1072768346 10:98114913-98114935 ACTCCAGAGTTGTTCAGTGAGGG No data
1072768341_1072768345 20 Left 1072768341 10:98114869-98114891 CCTGGAAGAAGTGATGGAGGAAC No data
Right 1072768345 10:98114912-98114934 TACTCCAGAGTTGTTCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072768341 Original CRISPR GTTCCTCCATCACTTCTTCC AGG (reversed) Intergenic