ID: 1072768342

View in Genome Browser
Species Human (GRCh38)
Location 10:98114881-98114903
Sequence GATGGAGGAACAGTATTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072768338_1072768342 1 Left 1072768338 10:98114857-98114879 CCAAGAAGTCTTCCTGGAAGAAG No data
Right 1072768342 10:98114881-98114903 GATGGAGGAACAGTATTCTAAGG No data
1072768335_1072768342 22 Left 1072768335 10:98114836-98114858 CCCAGCTCAAACTGGCTGGGTCC No data
Right 1072768342 10:98114881-98114903 GATGGAGGAACAGTATTCTAAGG No data
1072768336_1072768342 21 Left 1072768336 10:98114837-98114859 CCAGCTCAAACTGGCTGGGTCCA No data
Right 1072768342 10:98114881-98114903 GATGGAGGAACAGTATTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072768342 Original CRISPR GATGGAGGAACAGTATTCTA AGG Intergenic