ID: 1072768343

View in Genome Browser
Species Human (GRCh38)
Location 10:98114882-98114904
Sequence ATGGAGGAACAGTATTCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072768338_1072768343 2 Left 1072768338 10:98114857-98114879 CCAAGAAGTCTTCCTGGAAGAAG No data
Right 1072768343 10:98114882-98114904 ATGGAGGAACAGTATTCTAAGGG No data
1072768335_1072768343 23 Left 1072768335 10:98114836-98114858 CCCAGCTCAAACTGGCTGGGTCC No data
Right 1072768343 10:98114882-98114904 ATGGAGGAACAGTATTCTAAGGG No data
1072768341_1072768343 -10 Left 1072768341 10:98114869-98114891 CCTGGAAGAAGTGATGGAGGAAC No data
Right 1072768343 10:98114882-98114904 ATGGAGGAACAGTATTCTAAGGG No data
1072768336_1072768343 22 Left 1072768336 10:98114837-98114859 CCAGCTCAAACTGGCTGGGTCCA No data
Right 1072768343 10:98114882-98114904 ATGGAGGAACAGTATTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072768343 Original CRISPR ATGGAGGAACAGTATTCTAA GGG Intergenic