ID: 1072772092

View in Genome Browser
Species Human (GRCh38)
Location 10:98150688-98150710
Sequence GTTCATTCCACAAGTCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072772092_1072772097 18 Left 1072772092 10:98150688-98150710 CCCAGGTGACTTGTGGAATGAAC No data
Right 1072772097 10:98150729-98150751 GCTGAACAGCTGTTTTGATTTGG No data
1072772092_1072772094 -9 Left 1072772092 10:98150688-98150710 CCCAGGTGACTTGTGGAATGAAC No data
Right 1072772094 10:98150702-98150724 GGAATGAACCTCCTACAGCGTGG No data
1072772092_1072772098 30 Left 1072772092 10:98150688-98150710 CCCAGGTGACTTGTGGAATGAAC No data
Right 1072772098 10:98150741-98150763 TTTTGATTTGGCATCTCGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072772092 Original CRISPR GTTCATTCCACAAGTCACCT GGG (reversed) Intronic