ID: 1072772093

View in Genome Browser
Species Human (GRCh38)
Location 10:98150689-98150711
Sequence GGTTCATTCCACAAGTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072772093_1072772097 17 Left 1072772093 10:98150689-98150711 CCAGGTGACTTGTGGAATGAACC No data
Right 1072772097 10:98150729-98150751 GCTGAACAGCTGTTTTGATTTGG No data
1072772093_1072772098 29 Left 1072772093 10:98150689-98150711 CCAGGTGACTTGTGGAATGAACC No data
Right 1072772098 10:98150741-98150763 TTTTGATTTGGCATCTCGTTTGG No data
1072772093_1072772094 -10 Left 1072772093 10:98150689-98150711 CCAGGTGACTTGTGGAATGAACC No data
Right 1072772094 10:98150702-98150724 GGAATGAACCTCCTACAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072772093 Original CRISPR GGTTCATTCCACAAGTCACC TGG (reversed) Intronic