ID: 1072772095

View in Genome Browser
Species Human (GRCh38)
Location 10:98150710-98150732
Sequence CAGCAGCACCACGCTGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072772095_1072772098 8 Left 1072772095 10:98150710-98150732 CCTCCTACAGCGTGGTGCTGCTG No data
Right 1072772098 10:98150741-98150763 TTTTGATTTGGCATCTCGTTTGG No data
1072772095_1072772097 -4 Left 1072772095 10:98150710-98150732 CCTCCTACAGCGTGGTGCTGCTG No data
Right 1072772097 10:98150729-98150751 GCTGAACAGCTGTTTTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072772095 Original CRISPR CAGCAGCACCACGCTGTAGG AGG (reversed) Intronic