ID: 1072772096

View in Genome Browser
Species Human (GRCh38)
Location 10:98150713-98150735
Sequence GTTCAGCAGCACCACGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072772096_1072772097 -7 Left 1072772096 10:98150713-98150735 CCTACAGCGTGGTGCTGCTGAAC No data
Right 1072772097 10:98150729-98150751 GCTGAACAGCTGTTTTGATTTGG No data
1072772096_1072772098 5 Left 1072772096 10:98150713-98150735 CCTACAGCGTGGTGCTGCTGAAC No data
Right 1072772098 10:98150741-98150763 TTTTGATTTGGCATCTCGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072772096 Original CRISPR GTTCAGCAGCACCACGCTGT AGG (reversed) Intronic