ID: 1072772096 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:98150713-98150735 |
Sequence | GTTCAGCAGCACCACGCTGT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1072772096_1072772098 | 5 | Left | 1072772096 | 10:98150713-98150735 | CCTACAGCGTGGTGCTGCTGAAC | No data | ||
Right | 1072772098 | 10:98150741-98150763 | TTTTGATTTGGCATCTCGTTTGG | No data | ||||
1072772096_1072772097 | -7 | Left | 1072772096 | 10:98150713-98150735 | CCTACAGCGTGGTGCTGCTGAAC | No data | ||
Right | 1072772097 | 10:98150729-98150751 | GCTGAACAGCTGTTTTGATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1072772096 | Original CRISPR | GTTCAGCAGCACCACGCTGT AGG (reversed) | Intronic | ||