ID: 1072772097

View in Genome Browser
Species Human (GRCh38)
Location 10:98150729-98150751
Sequence GCTGAACAGCTGTTTTGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072772095_1072772097 -4 Left 1072772095 10:98150710-98150732 CCTCCTACAGCGTGGTGCTGCTG No data
Right 1072772097 10:98150729-98150751 GCTGAACAGCTGTTTTGATTTGG No data
1072772096_1072772097 -7 Left 1072772096 10:98150713-98150735 CCTACAGCGTGGTGCTGCTGAAC No data
Right 1072772097 10:98150729-98150751 GCTGAACAGCTGTTTTGATTTGG No data
1072772093_1072772097 17 Left 1072772093 10:98150689-98150711 CCAGGTGACTTGTGGAATGAACC No data
Right 1072772097 10:98150729-98150751 GCTGAACAGCTGTTTTGATTTGG No data
1072772092_1072772097 18 Left 1072772092 10:98150688-98150710 CCCAGGTGACTTGTGGAATGAAC No data
Right 1072772097 10:98150729-98150751 GCTGAACAGCTGTTTTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072772097 Original CRISPR GCTGAACAGCTGTTTTGATT TGG Intronic