ID: 1072772098

View in Genome Browser
Species Human (GRCh38)
Location 10:98150741-98150763
Sequence TTTTGATTTGGCATCTCGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072772095_1072772098 8 Left 1072772095 10:98150710-98150732 CCTCCTACAGCGTGGTGCTGCTG No data
Right 1072772098 10:98150741-98150763 TTTTGATTTGGCATCTCGTTTGG No data
1072772096_1072772098 5 Left 1072772096 10:98150713-98150735 CCTACAGCGTGGTGCTGCTGAAC No data
Right 1072772098 10:98150741-98150763 TTTTGATTTGGCATCTCGTTTGG No data
1072772093_1072772098 29 Left 1072772093 10:98150689-98150711 CCAGGTGACTTGTGGAATGAACC No data
Right 1072772098 10:98150741-98150763 TTTTGATTTGGCATCTCGTTTGG No data
1072772092_1072772098 30 Left 1072772092 10:98150688-98150710 CCCAGGTGACTTGTGGAATGAAC No data
Right 1072772098 10:98150741-98150763 TTTTGATTTGGCATCTCGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072772098 Original CRISPR TTTTGATTTGGCATCTCGTT TGG Intronic