ID: 1072779838

View in Genome Browser
Species Human (GRCh38)
Location 10:98241162-98241184
Sequence ATTCCCTTCTTTTAGAGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072779838 Original CRISPR ATTCCCTTCTTTTAGAGTGA CGG (reversed) Intronic
902524061 1:17042767-17042789 ATTCCTTTTTTTTTGAGTCAGGG - Intronic
902785553 1:18730705-18730727 ATCCCCTTCTTTTAAAGTAGGGG + Intronic
905388984 1:37624252-37624274 CTTCTTTTCTTTTAGAGAGAGGG - Intronic
905768718 1:40623953-40623975 ATTACCTTCTTTTAGAGAGGTGG + Exonic
906217165 1:44049487-44049509 ATTCTTTTCTTTTTGAGAGAAGG + Intergenic
907800706 1:57762531-57762553 ATAACCTTCTTTTAGAATTATGG - Intronic
907868068 1:58418001-58418023 CTTCCCTTCCAATAGAGTGAAGG - Intronic
908503324 1:64767834-64767856 AATCCTTTCTGTTAGACTGATGG - Intronic
909098258 1:71316859-71316881 ATTCCCTTCCTGTTGAGTGTGGG - Intergenic
910060728 1:83088550-83088572 ATTCCCTTGATTTAGAATGAAGG + Intergenic
910369920 1:86504354-86504376 CTTCCTTTCTTTCAGAGTAAGGG + Intergenic
910581072 1:88825503-88825525 ATTCCTTACTTTCAGATTGAAGG - Intronic
910868057 1:91805815-91805837 ATGCCCTCATTTTAGAGTGATGG + Intronic
912534784 1:110358898-110358920 AATTCCTTCTTTTATAATGATGG + Intergenic
914356325 1:146887615-146887637 GTCCCCTTCTTTTACAGAGAAGG + Intergenic
916346105 1:163793059-163793081 AATCCCTTCCTTTTGAGTGTAGG - Intergenic
916402952 1:164468723-164468745 ATGACCTTCTATTAGAGTGTAGG - Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
917983240 1:180287664-180287686 ATTCCTTTCTTGTTTAGTGAAGG + Intronic
918001424 1:180501170-180501192 ATGCCCTTCTTTTACAGTAAAGG - Intronic
920089014 1:203439102-203439124 TTTCCCATCTTATAAAGTGAGGG + Intergenic
920411816 1:205767618-205767640 AATACCTTCTTTTAAAATGAAGG - Intergenic
920988981 1:210917702-210917724 ATTTCCTTCTCTTAGAGGGAGGG - Intronic
921082495 1:211753973-211753995 ATTTCCTGCTTAGAGAGTGAAGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1065867800 10:29928758-29928780 ATTCCCTTCCTTGAAAGTGGTGG + Intergenic
1067471009 10:46537721-46537743 CTCCCCTTCTTTAAGAGTGGAGG + Intergenic
1068055034 10:52002203-52002225 ACTGCCTTCTTTTTCAGTGATGG + Intronic
1068124796 10:52826425-52826447 TTTCCTTACTTTTAGAGAGAAGG - Intergenic
1069323588 10:67204022-67204044 ATTTTCTTCTTTTAAAGAGAGGG - Intronic
1071791759 10:88962215-88962237 AATCCCTTCATTTAAAATGATGG + Intronic
1072779838 10:98241162-98241184 ATTCCCTTCTTTTAGAGTGACGG - Intronic
1074350320 10:112730435-112730457 TTTACATTCATTTAGAGTGAGGG + Intronic
1075044709 10:119137771-119137793 CCTCCCTTTTTTTTGAGTGAGGG + Intronic
1075250437 10:120865633-120865655 ATACCCTGCTTTCAGCGTGATGG + Exonic
1076017708 10:127041551-127041573 TTTCCTTTCTTTTGGAGAGATGG + Intronic
1077986622 11:7358260-7358282 ATTGTCTTCTTTTAAAGTTATGG + Intronic
1078462392 11:11524166-11524188 ATTCCCTACTTTTTGAGTCTTGG - Intronic
1078525157 11:12095091-12095113 ATGCCCTTCTTTTACAGATAAGG + Intronic
1081149762 11:39613090-39613112 ATTCCATGCATTTAGAGTAAGGG - Intergenic
1081789082 11:45770024-45770046 ATTCCCTTCTTTAAAAGACAAGG - Intergenic
1082613530 11:55331823-55331845 ATTCCCTCCTTTTCTATTGATGG + Intergenic
1082942578 11:58723499-58723521 ATTCCCTTCTTTCAGTATAAAGG - Intronic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083911927 11:65714875-65714897 ATCTCCTTCTTTGAGATTGATGG + Exonic
1085219977 11:74865445-74865467 ATTCCCTGATTGTAGAGGGAGGG - Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086557408 11:88127353-88127375 ATTCCCTTCTTTGAGATGGGAGG - Intronic
1089023248 11:115240414-115240436 CTTCCCTTTTTTTAAGGTGATGG - Exonic
1090039639 11:123279313-123279335 ATTTCCTTCTTCTTGAATGATGG - Intergenic
1091869101 12:3872692-3872714 ATTCCCTTGCTTTAGACTGGTGG + Intronic
1092542290 12:9427459-9427481 GTCATCTTCTTTTAGAGTGAAGG - Intergenic
1093684422 12:22040062-22040084 GTTCTCTTCTTTTAGATAGATGG - Intergenic
1094012603 12:25825071-25825093 TTTCCCTGATGTTAGAGTGAAGG + Intergenic
1094217180 12:27955461-27955483 ATGCACTTGTTTTACAGTGATGG + Intergenic
1094398293 12:30032597-30032619 ATTCCCTTCTTTTATTGTCCAGG - Intergenic
1094510724 12:31094974-31094996 GTCATCTTCTTTTAGAGTGAAGG + Intronic
1095354028 12:41249872-41249894 CTTTCCTTCATTTATAGTGAGGG + Intronic
1095827866 12:46549177-46549199 ATTCCCCTTCTTTAAAGTGAGGG - Intergenic
1095864268 12:46954491-46954513 ATTCTCTTCTTTCAGAGAAAGGG - Intergenic
1096837765 12:54361983-54362005 ATTCCCTTCGCACAGAGTGAGGG + Intergenic
1098014868 12:66093814-66093836 ATTTACTTATTTTAAAGTGAAGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1099090037 12:78295162-78295184 AGTCTCTTCTTTTATAGGGAGGG - Intergenic
1099488830 12:83262051-83262073 AGTCCCTTCTTGAAGGGTGATGG + Intergenic
1099632943 12:85174032-85174054 ATTTGCTTCTTTTAGAGTGGGGG - Intronic
1102583788 12:113909127-113909149 ATTCTATTTTTTTAGAGAGAAGG + Intronic
1106541241 13:30691770-30691792 ATTACCTTTTTTTAGAGACAGGG + Intergenic
1106872221 13:34034076-34034098 CTTCCCTTCTCTTGGAGTCATGG - Intergenic
1108338066 13:49466649-49466671 ATTCATTTATTTTAGAGAGAGGG + Intronic
1108443838 13:50486055-50486077 ATTCTCTTCTTTTAGAAGCAGGG - Intronic
1109824968 13:67706902-67706924 ATTCACTTCTTCTATATTGATGG + Intergenic
1110268217 13:73563785-73563807 ATTTCTTTTTGTTAGAGTGATGG - Intergenic
1112767601 13:102762557-102762579 ATTATCTTTTTTTAGAGAGACGG - Intergenic
1112921723 13:104621630-104621652 AATCCCCTCTCTTAGAGTGTGGG + Intergenic
1113397479 13:109962063-109962085 ATTCTGTTCTTTTAGAGCCAGGG - Intergenic
1114574852 14:23702912-23702934 ATTTTTTTCTTTTACAGTGAAGG - Intergenic
1115065858 14:29258619-29258641 ATTCTCTAGTTTTAAAGTGAGGG - Intergenic
1115496290 14:34007887-34007909 AATTCCTTCTTTTTGAGTGTAGG + Intronic
1115933594 14:38526698-38526720 GTTCCCTTCTTTCTGACTGAGGG + Intergenic
1116275829 14:42830001-42830023 TTTACCTTCTTTTAGAAGGATGG - Intergenic
1116291734 14:43051784-43051806 ATTCCCTTCTTAGAAGGTGAGGG - Intergenic
1116603513 14:46959669-46959691 ATTGCCTTCTTTTAGATGGATGG + Intronic
1117055674 14:51909957-51909979 ATTCCATTCTTTCAGAGTCCTGG - Intronic
1117162915 14:53006748-53006770 ATTCCCTTCGGTGAGAGTTACGG - Intergenic
1117329479 14:54698083-54698105 ATTCCCTTCCTTCTGAGTGCAGG - Intronic
1117661611 14:58011929-58011951 AATCCCTTCTTTTAGAATACAGG - Intronic
1117979409 14:61327857-61327879 ATTTCTTTCTTTTAGAAAGATGG - Intronic
1118563445 14:67113027-67113049 ATTCCCCTCTTTTAATGTCATGG - Exonic
1118724180 14:68615999-68616021 CTTGCCTTCTTTTGAAGTGAGGG + Intronic
1120353770 14:83401089-83401111 AATCCCCTCTTTTTGAGTGGGGG + Intergenic
1120702709 14:87715386-87715408 ATTATTTTCTTTTAGAGGGAAGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1122777160 14:104124254-104124276 TTTGCCTTCTTTTGGATTGATGG + Intergenic
1124184308 15:27509996-27510018 TTGCCCTGCTTTTAGTGTGAGGG + Intronic
1124373610 15:29116936-29116958 ATGCCCATCTCCTAGAGTGAAGG - Intronic
1125355113 15:38809405-38809427 ATTCTCTGCTTTTAGAGTCCAGG + Intergenic
1126041932 15:44599856-44599878 ATTCCCTTTTTTTAAAGTTCTGG + Intronic
1128739307 15:70072659-70072681 ATGCCCTTGTTTTACAGAGAGGG - Intronic
1131500779 15:92963626-92963648 ATTGCTTTCTTTTAGTCTGAAGG + Intronic
1131592777 15:93767798-93767820 ATTCCCATCTTTCAGATGGATGG + Intergenic
1138119328 16:54385938-54385960 ATTCTCTTATTTTAGAGATATGG - Intergenic
1139977691 16:70827848-70827870 GTCCCCTTCTTTTACAGAGAAGG - Intronic
1140585010 16:76278940-76278962 GGTTCCTTCTTTCAGAGTGATGG - Intronic
1143074902 17:4333312-4333334 CTTCTCTTCTTTTAAAATGATGG - Intronic
1143084503 17:4405753-4405775 ATGCCATTCTTTTTGAGTGATGG + Intergenic
1143799925 17:9370346-9370368 CTATCCTCCTTTTAGAGTGAAGG + Intronic
1143950882 17:10631434-10631456 ATGCCCTTCTTCTAAAGTGCAGG + Intronic
1144142108 17:12359629-12359651 ATTCCCTTCTTTTCATTTGATGG + Intergenic
1144189423 17:12830654-12830676 ATTCCCTCATTTTACAGTGGGGG - Intronic
1144456813 17:15425652-15425674 ATTCCCTTCTTCTGGAGTGCGGG - Intergenic
1147551528 17:41446043-41446065 ATTCCCTTCTCTTAGAGCGATGG - Intergenic
1147675167 17:42200291-42200313 ATGCCCTTCTTTTGGAGAGGGGG + Exonic
1149007696 17:51822579-51822601 ATTCCATTCTAATGGAGTGAAGG - Intronic
1150827494 17:68489958-68489980 AATCTTTTCTTTTAGAGAGAGGG + Intergenic
1151562158 17:74876304-74876326 ATTGCCTTGTTTTTCAGTGAAGG - Intergenic
1151891854 17:76955797-76955819 ATTTCCTATTTTTAGAGTCAGGG + Intergenic
1152300711 17:79493968-79493990 CTTCCCCACTTTTAGAATGATGG - Intronic
1153284951 18:3448961-3448983 CTTTCCTTTTTTTAAAGTGATGG + Intronic
1153364052 18:4233642-4233664 ATTCCCTTCCCTTTGAGTGTTGG - Intronic
1155280665 18:24236349-24236371 GTTCCCTTGTAATAGAGTGAAGG + Intronic
1156056160 18:33006600-33006622 AATCCCTTCTTTTTGAGTATGGG + Intronic
1156303403 18:35854932-35854954 ATTGTCTTTTTTTAAAGTGAGGG - Intergenic
1156322581 18:36040858-36040880 ATTGCTTCCTTTTAGAGTGGAGG - Intronic
1156900431 18:42294765-42294787 ATTAACTTCTTTTAAAGTGAAGG + Intergenic
1158917145 18:62144959-62144981 ATTCCATTCCTTTAGAGACACGG + Intronic
1159467466 18:68803466-68803488 TGTCCCTTCTGTTAGGGTGAAGG + Intronic
1159622716 18:70656894-70656916 TTTCTCTTCTGTAAGAGTGACGG + Intergenic
1162065490 19:8122964-8122986 AGCCCCTTCTTTTATAGTCAGGG + Intronic
1164531452 19:29051357-29051379 GTTTCCTTCTTTTAAAGTAAGGG + Intergenic
1164699186 19:30270606-30270628 ATTCGCGTCTTTTAGAGTGATGG + Intronic
1165373492 19:35425215-35425237 ATTTCCTCCATTTAGAGGGAAGG + Intergenic
1166002382 19:39885564-39885586 ATTTATTTCTTTTAGAGTCAGGG - Intronic
1166005165 19:39901816-39901838 ATTTATTTCTTTTAGAGTCAGGG - Intronic
1166671925 19:44715430-44715452 ATCCCCTTCATTAAGAGTGTAGG + Intergenic
925185239 2:1842532-1842554 ATTCCCTCCTTTAAGAGGGCGGG - Intronic
926711514 2:15885856-15885878 ACTCTCTTCTTTTAGGGTCAAGG - Intergenic
927603953 2:24469649-24469671 CTTCCCTTTTTTTGGAATGAAGG + Intergenic
928016521 2:27663141-27663163 ATCCCCATTTTTCAGAGTGAGGG + Intronic
928863747 2:35893378-35893400 AATCCCTTATTTTAAACTGATGG + Intergenic
929262704 2:39883441-39883463 ATTCTCTTCCTTGAGAGTTAGGG + Intergenic
929876279 2:45799555-45799577 ATTCTTTTCTTTTAGAGACAGGG - Intronic
930056589 2:47257033-47257055 ATTCGCTTCTTTAGGAGGGACGG + Intergenic
930228845 2:48823202-48823224 ATTCTCTTCTTTTACAGTTAAGG - Intergenic
930782568 2:55237385-55237407 CTTCCCTTCTGTTACAGAGAAGG + Exonic
930786284 2:55274429-55274451 CTTCCTTCCTTTTAGAGTCAGGG - Intergenic
931091192 2:58888251-58888273 ATTCCTTTCTCTTTTAGTGAAGG + Intergenic
932182370 2:69659445-69659467 TATCTCTTCTTTTAGAGAGAAGG + Intronic
933770321 2:85739906-85739928 TTTTTCTTCTTTTAGAGTTAGGG - Intergenic
933802521 2:85974605-85974627 ATTCCCTTCTTTAAATGTCAAGG + Intergenic
934139232 2:89029693-89029715 ATTACATTATTTTAGAGAGAAGG + Intergenic
934230014 2:90170866-90170888 ATTACATTATTTTAGAGAGAAGG - Intergenic
934719439 2:96563173-96563195 ATTCCCTTCCTCTTGAGTGTGGG + Intergenic
935007777 2:99097633-99097655 CTTGCCTTCTTTTGGATTGATGG - Intronic
935544987 2:104391421-104391443 TTTTCCTTCTTTTAGAGACAGGG - Intergenic
936453726 2:112654104-112654126 TTTACCTTATTTTAGATTGAGGG + Intronic
937363175 2:121243017-121243039 ATTCCCTTCATTTACAGAGTGGG + Intronic
937563593 2:123256473-123256495 AGTCTTTTCTTCTAGAGTGAAGG + Intergenic
939373047 2:141327613-141327635 ATTCCCTTCTTTTTAGGAGAAGG - Intronic
939685269 2:145191021-145191043 AATCCCTTCCCTTAGAGTGTGGG + Intergenic
940165926 2:150771195-150771217 ATTCTCTTATTTCAGATTGATGG - Intergenic
940526437 2:154820890-154820912 ATTACCAACTTTTAGAGTAAAGG + Intronic
942258592 2:174133887-174133909 ATTGCTTTATTTTGGAGTGATGG - Intronic
942311455 2:174660789-174660811 GTAACCTTCTTTTAGAGTGGAGG - Intronic
943324183 2:186478258-186478280 ATTCCCCTCTTTTTTAGTGTTGG - Intergenic
943523585 2:188987822-188987844 ATTCCCTTCCTTAAGAGTTCAGG + Intronic
943625989 2:190200119-190200141 ATTCCATACATTGAGAGTGAGGG + Exonic
944195770 2:197051398-197051420 ATTCATTTATTTTAGAGAGAGGG + Intronic
944295194 2:198053593-198053615 ATTCCCTCTTTTTAGAATGTTGG + Intronic
946882746 2:224192862-224192884 ATTGGCTTCATTAAGAGTGAAGG + Intergenic
947252189 2:228120156-228120178 ATTCTCTCCTTTTACTGTGAAGG + Intronic
948400808 2:237683630-237683652 AAACCCTTCTATTAGAGTGTGGG + Intronic
1169398018 20:5252804-5252826 CTTCCTTTCTTTTAGAGACAGGG + Intergenic
1169447205 20:5682449-5682471 ATTCCATCCATTTAGAGGGAAGG + Intergenic
1170455990 20:16533242-16533264 ATTCCTATCTTTTGGGGTGATGG - Intronic
1174208317 20:48857295-48857317 AGTCACTTCTTTTAGAGAGAAGG - Intergenic
1176281237 20:64314227-64314249 TTTCTCTTTTTTTAGAGAGATGG - Intergenic
1177420374 21:20848935-20848957 TTTCCCTTCTTTCTGAGTAACGG + Intergenic
1177485579 21:21751107-21751129 TTTCCCTTCTTTTGCAGTGTAGG + Intergenic
1178191260 21:30283644-30283666 AATCCCTTCTTAAAGAGTGTCGG + Intergenic
1178235906 21:30841012-30841034 ATTCTTTTCTTTAAGAATGAAGG + Intergenic
1179257742 21:39731411-39731433 ATTCCCTTCTCTTTGAGTGTGGG + Intergenic
1182195920 22:28517503-28517525 ATTCCTTTTTTTGAGGGTGAAGG - Intronic
1183287727 22:36977903-36977925 ATTTACTTATTTTAGAGTCAGGG - Intergenic
1183732572 22:39627090-39627112 TTTCCGTTCTTTTAGCGTGTAGG + Intronic
950499148 3:13353017-13353039 ATTCCCTTGATTGGGAGTGAGGG - Intronic
950604780 3:14068932-14068954 ATGTCCTTCCTATAGAGTGAAGG + Intronic
951639183 3:24815329-24815351 ATTTCCTAATTTTAGAATGAAGG - Intergenic
952245069 3:31579098-31579120 ATGTTCCTCTTTTAGAGTGAGGG + Intronic
955964306 3:64372259-64372281 ATTCCCTTTTTTAACAGAGAAGG - Intronic
956033179 3:65061458-65061480 GTACCCTTCCATTAGAGTGATGG - Intergenic
956055433 3:65293608-65293630 ATCCCCTTCTTTTCTAGTAATGG - Intergenic
956132107 3:66063887-66063909 TTTCCTTTCTTTTAGAGACAAGG + Intergenic
956650941 3:71504101-71504123 TTTCCCTTCTTATAAAATGAAGG + Intronic
957242842 3:77681321-77681343 ATTCCCTTATTTTTTAGAGAAGG - Intergenic
957425474 3:80033874-80033896 ATTACATTCTTTGAGAGTGCAGG + Intergenic
960325291 3:116288077-116288099 TTTTCTTTGTTTTAGAGTGAAGG + Intronic
961944415 3:130671161-130671183 TTTCCCTGCTTTTAGACTTAAGG + Intronic
961970035 3:130953671-130953693 ATTCTGGTCTTTTAGAGTGATGG + Intronic
962185810 3:133258368-133258390 ATGCCCTTCTTGTAGCTTGATGG - Intronic
963002268 3:140693286-140693308 ATTTCCTTCTCTTACAGGGAGGG - Intronic
963154376 3:142079900-142079922 ATCCTTTTCTTTTAGATTGAAGG - Intronic
963819858 3:149877994-149878016 ATTCCCTTCTTTTACCAGGAAGG + Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965142893 3:164862423-164862445 ATTCCCTCCCTGTTGAGTGAGGG + Intergenic
965474694 3:169141206-169141228 ATTCCGTTTTTTTAGAGTCCAGG + Intronic
967407224 3:189130625-189130647 ATTCCCTTCTGTGAGTGTGAGGG + Intronic
967733528 3:192928942-192928964 ATGCCCTTCCTTTAGAGGGCAGG - Intergenic
969233360 4:5847482-5847504 AATCCCTTCTTTTTGAGTGTGGG + Intronic
969449668 4:7265849-7265871 ATTCCCTTCCTGCAGAGGGAGGG + Intronic
970317838 4:14846298-14846320 ATTCCTTTCTCTTAGAGCCATGG - Intergenic
970510301 4:16775434-16775456 ATTACCATTTTTTACAGTGAAGG - Intronic
971648446 4:29238773-29238795 AATCCCTTCTCTTTGAGTGGAGG - Intergenic
973874095 4:55197736-55197758 ATTCCCTTCTTTTATGTTGCTGG - Intergenic
975148645 4:70996767-70996789 GTTCCCTTATGTTAGATTGATGG + Intronic
975454134 4:74569553-74569575 ATTCCCCTCTGTAAGTGTGAGGG - Intergenic
975972389 4:80056403-80056425 ATTTCCCACTTTTAGAGAGATGG - Intronic
976616267 4:87080653-87080675 ATCCCCTTCTTTTACAGAGATGG - Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979753378 4:124307265-124307287 ACAGTCTTCTTTTAGAGTGATGG - Intergenic
981039911 4:140213558-140213580 ATTCCGTTCTTTGAGATTGCAGG + Intergenic
982378018 4:154715973-154715995 ATTTCCTTCTGTAAGAGTGGAGG - Intronic
982482226 4:155925862-155925884 GTTCCCTTCTTGTAGAGAGATGG - Exonic
982918027 4:161238864-161238886 ACTGTCTTCTTTTACAGTGATGG - Intergenic
983706249 4:170663658-170663680 CTTCCCTTCTTTGACAGAGATGG + Intergenic
984560696 4:181265478-181265500 ATTTCCTACTTTTAGCCTGATGG + Intergenic
985869203 5:2540581-2540603 TTTCACTTCTTTTTCAGTGATGG + Intergenic
986059985 5:4178798-4178820 ATTCCCTTCTCTTCCAGTGTAGG - Intergenic
986170002 5:5307456-5307478 ATTCTCTCCTTTTGGAGAGATGG + Intronic
987809339 5:22813511-22813533 GATCCCTTCTCTTTGAGTGAGGG + Intronic
988306853 5:29504016-29504038 ATTCCCCTCTTTTACTGTGAGGG - Intergenic
988802003 5:34704964-34704986 ATTTCTTTCTTTTAGAGACAGGG + Intronic
990636348 5:57732127-57732149 ATTTCCTTGGTTTAGAGAGAAGG + Intergenic
990782904 5:59386165-59386187 AGTCCATTCTTTTAGATTGTTGG + Intronic
990949124 5:61278861-61278883 ATTGCCTACTATTGGAGTGAAGG + Intergenic
991403950 5:66283674-66283696 ATTCTCTTCATTTTGAGTTATGG + Intergenic
993526173 5:88968417-88968439 ATTGCCTTATTTTAGAATGTGGG + Intergenic
994822645 5:104673971-104673993 ATTTTTTTCTTTTAGAGAGAGGG + Intergenic
996570675 5:124929736-124929758 CTTCCTTTCTTTTAGAGACAGGG + Intergenic
997530304 5:134577703-134577725 ATCCCCTTCTTTTTGCGGGAGGG - Intronic
998617906 5:143761138-143761160 ATTCCCTTCCTCTTGAGTGTAGG - Intergenic
998798867 5:145847827-145847849 ATTCTTTTCTTTTAGTGTCAAGG - Intergenic
998872637 5:146567840-146567862 ATTCCCTTCCTCTTGAGTGTGGG + Intergenic
1000433125 5:161174933-161174955 ATTCAGTTCATTTAGAGTGAAGG + Intergenic
1000467960 5:161603684-161603706 ATTCATTTATTTTAGAGAGAAGG + Intronic
1001120515 5:168976158-168976180 ATTACCTACTTTTATAGGGAGGG + Intronic
1002032024 5:176437089-176437111 ATTCCTTTCTTTAAGTGTAAAGG + Intergenic
1004964476 6:20832647-20832669 ATTTCCTTTTTTTAGAGACAGGG - Intronic
1006410188 6:33869065-33869087 ATTTCATTGTTTTAAAGTGAAGG - Intergenic
1006693707 6:35912787-35912809 CTTCCCTTCTTTTGGAGACAGGG + Intronic
1007141270 6:39576942-39576964 ATTCCCTTCTTTGAGGGGAAAGG + Intronic
1007605191 6:43112998-43113020 TTTTTCTTCTTTTAGAGTCAGGG + Intronic
1008197761 6:48545829-48545851 TTTCTCTTCTTTAAGAGTGTTGG - Intergenic
1008446794 6:51600976-51600998 ATGTCCTTGTTTTAGAGAGAAGG - Intergenic
1010678647 6:78773340-78773362 ATTACCTTCATTTACAGAGAAGG + Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012381476 6:98624571-98624593 ATGTCCTTCTTTTTGAGTGTGGG - Intergenic
1014922625 6:127230338-127230360 ATTCTTTTCTTTAAGAGTGTTGG - Intergenic
1015035352 6:128646670-128646692 ATTCCCTTATTTCATAGTGGAGG + Intergenic
1015515267 6:134077170-134077192 AATCCCTTCTTCTTGAGTGTGGG - Intergenic
1020027634 7:4910477-4910499 ATTCCCATTCTTTCGAGTGATGG - Intronic
1021663822 7:22952144-22952166 GTTCCCTTATTATATAGTGAGGG - Intronic
1023362341 7:39429783-39429805 AATCTCTTCTTTGAGAATGAAGG - Intronic
1023395663 7:39749679-39749701 ATTGCCTACTTTCAAAGTGAGGG - Intergenic
1023486170 7:40689573-40689595 ATGCCCTTCATATAGTGTGAAGG - Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027810063 7:82885065-82885087 ATTCCCTTCCGTTTGAGTGAAGG + Intronic
1028137878 7:87241608-87241630 ATTCCCTCCTTTTCTATTGATGG - Intergenic
1028756679 7:94443064-94443086 ATTGCCTTCTCTTCCAGTGAAGG + Intergenic
1031152695 7:118073129-118073151 TTTCCCTTCTTTTCAGGTGACGG - Intergenic
1031751700 7:125582874-125582896 ATCATCTTCTTTTTGAGTGAAGG + Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1035986191 8:4434465-4434487 CTTTCCTTCTGTTAGAGTGTGGG - Intronic
1038682287 8:29679812-29679834 ATTCCCTTCTTCAACAGTGAAGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1041896790 8:62934210-62934232 TTTCCTTTTTTTTAGAGAGAAGG - Intronic
1042254935 8:66792905-66792927 ATACCTTTCTTTTAGAGACAGGG - Intronic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1049678405 8:143903877-143903899 ATTCCCTTTCCTTAGAGTGTGGG + Intergenic
1050071507 9:1819524-1819546 ATTGCCTACTTTTAAAGTAAAGG - Intergenic
1050841342 9:10152827-10152849 ATTTCCTTCTTTTTGGGGGAGGG - Intronic
1051609284 9:18945620-18945642 AATCCCATCTGTTATAGTGAAGG - Intronic
1052205685 9:25837135-25837157 ATTCCTTTCTTTTCAATTGAAGG - Intergenic
1052466046 9:28830595-28830617 ATTCCCTCCTTTTAGGGAGTTGG - Intergenic
1056811733 9:89770478-89770500 ATTTCCTTCTTTTGGGGTTAAGG + Intergenic
1057567164 9:96175138-96175160 AATCCCTTCCTTTTGACTGATGG - Intergenic
1058151393 9:101467370-101467392 ATTCCTTTCTTGAAGAGTAAAGG + Intergenic
1058297110 9:103322918-103322940 TTTCCTTTATTTTTGAGTGAAGG - Intergenic
1058444624 9:105043809-105043831 ATTCTCTTCTGTTAGACTGTAGG + Intergenic
1058536605 9:105966849-105966871 ATTCTCTTCTTTCATAGGGAAGG - Intergenic
1059092988 9:111381198-111381220 CTTCCCTTCATTTAGACAGAGGG + Intronic
1059607132 9:115845664-115845686 ATTCCCTCCCTCTAGAGTGGAGG + Intergenic
1059938015 9:119331098-119331120 ATTCAGTTCTTGTAGTGTGATGG + Intronic
1060641692 9:125244284-125244306 TTACCCCTATTTTAGAGTGAAGG + Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187794861 X:22992873-22992895 ATGCCCTTTTTGTAGAATGATGG - Intergenic
1188917294 X:35927558-35927580 CTGCCCTTCTTTTGGTGTGATGG + Intronic
1189689140 X:43597400-43597422 ATTTCATTCTTTTTGAGTGTGGG - Intergenic
1190316181 X:49152937-49152959 ATAGCCTTTTTTTAGAGAGATGG - Intergenic
1191222146 X:58001022-58001044 ATTCCTTTCTTTAGGAATGAAGG - Intergenic
1192100378 X:68258099-68258121 ATTCCCTTCTACTCTAGTGAAGG + Intronic
1194667944 X:96696238-96696260 TTTCTTTTCTTTTAGAGTCAGGG - Intronic
1196600984 X:117601724-117601746 GTTCCCTTCTTTTACACTGTTGG - Intergenic
1197815835 X:130497354-130497376 CCTCCCTTTTTTTTGAGTGAGGG + Intergenic
1198515605 X:137403674-137403696 CTTCCTTTCTTTTAGAGACAGGG - Intergenic
1200255165 X:154577558-154577580 TTTCCCTTTTTTTAGAGTCAAGG + Intergenic
1200262604 X:154626846-154626868 TTTCCCTTTTTTTAGAGTCAAGG - Intergenic
1201343765 Y:12960431-12960453 TTTCCCTTCTGTTCCAGTGAGGG - Intergenic