ID: 1072780550

View in Genome Browser
Species Human (GRCh38)
Location 10:98248399-98248421
Sequence AAATAACAACAGATGAAGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1120
Summary {0: 1, 1: 0, 2: 5, 3: 97, 4: 1017}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072780550 Original CRISPR AAATAACAACAGATGAAGAA AGG Exonic
900304211 1:1995503-1995525 AAAAAAAAACAGTTGAAGAACGG + Intronic
902128174 1:14235132-14235154 AAATGACATCAGCTGATGAATGG + Intergenic
902697813 1:18152059-18152081 ATATAGCAACAGAGGGAGAAAGG - Intronic
902959413 1:19951928-19951950 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
903369179 1:22824317-22824339 AAAGAAGAAAAGAAGAAGAAAGG + Intronic
903881930 1:26516406-26516428 AAAAAAAAAAAGAAGAAGAAGGG - Intergenic
904205166 1:28849822-28849844 GAATAACAAGAGAAGAAGAAAGG + Intronic
904511830 1:31017311-31017333 AACCTACTACAGATGAAGAAAGG + Intronic
905192672 1:36247859-36247881 AAAAAAAAAAAGATGAAGATGGG - Intronic
905231907 1:36519858-36519880 AAAAAAAAACAGATGATGGATGG - Intergenic
905603753 1:39277521-39277543 AGATAACAACAGATGTATGAAGG - Intronic
905928915 1:41772487-41772509 AAAGAACAACAGAAGAGGGAAGG + Intronic
906174677 1:43760816-43760838 AATACACAACAGCTGAAGAAGGG + Intronic
906231343 1:44167253-44167275 AAACAATAAAAGATGAAGAAAGG - Intergenic
906895937 1:49772051-49772073 AAATAACTAGAGAGGAAGAAAGG - Intronic
907493195 1:54823640-54823662 AAACAATAAAAGAGGAAGAAAGG - Intronic
907676507 1:56522510-56522532 ACAAAAAAAAAGATGAAGAATGG + Intronic
908145358 1:61235513-61235535 AAATAAAAAAAAATGAACAAAGG + Intronic
908297498 1:62727658-62727680 ACATAACAAAATTTGAAGAATGG - Intergenic
908800460 1:67874832-67874854 AAATAATAACAGAGCAAGTAGGG - Intergenic
909195653 1:72618824-72618846 AAAAAAAAAAAGAAGAAGAATGG + Intergenic
909525813 1:76621294-76621316 AAATAACAAAAAATGGAAAATGG - Intronic
909679551 1:78276676-78276698 GAAAAACAACAAATGAGGAAAGG - Intergenic
909726536 1:78842819-78842841 AAATAGCAAAGTATGAAGAAAGG - Intergenic
909770099 1:79411369-79411391 AAAGAACAAAAGATAGAGAAGGG + Intergenic
910440946 1:87251083-87251105 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
910454194 1:87378422-87378444 AAATAAAAAAAGACAAAGAAGGG - Intergenic
910521011 1:88122552-88122574 AAATACGAACTGATGAATAATGG + Intergenic
910565035 1:88634009-88634031 AAACAATAAGAGAGGAAGAAAGG - Intergenic
910636259 1:89411703-89411725 AAAAAAAAATAAATGAAGAAAGG - Intergenic
911363179 1:96904983-96905005 AAAAAGCAACACATGAGGAAAGG - Intergenic
911744874 1:101430304-101430326 CAATAACAACAAAAAAAGAAGGG + Intergenic
912049586 1:105509304-105509326 AAATAACAACTGAGCAGGAAAGG + Intergenic
913260114 1:116990060-116990082 CGATGACAACAGAGGAAGAAGGG + Exonic
914370976 1:147023949-147023971 AGATAACATCAAAGGAAGAAAGG + Intergenic
914678887 1:149925189-149925211 AAAGAACACTAGAAGAAGAATGG + Intronic
914822741 1:151117573-151117595 AAAAAAGAAAAGATGAAGAAGGG - Intronic
915113233 1:153578059-153578081 TAATCACAATGGATGAAGAAGGG - Intergenic
915143831 1:153782976-153782998 AAAAAAAAACAGATGAACTAGGG + Intergenic
915244553 1:154547177-154547199 AAATAACAGCAGATAAAGGGAGG - Intronic
915888276 1:159746931-159746953 AAATAAAAGGAGAAGAAGAAAGG + Intergenic
916297000 1:163230025-163230047 AAGTAAAAAGAGATGAAGAGAGG - Intronic
916602533 1:166306930-166306952 AAAGAGGAAGAGATGAAGAAGGG + Intergenic
916714466 1:167438009-167438031 AAATAAAGACAGAGGAAGGAAGG + Intronic
916736735 1:167614182-167614204 AAAAAACAACAAAGGAAGGAAGG - Intergenic
916842370 1:168613626-168613648 TAATAAAAACAGATGCAGATTGG - Intergenic
916902312 1:169241370-169241392 AAATGACAACACATTAAAAAAGG + Intronic
916917049 1:169418247-169418269 AAATATCTACAAATGAAGAATGG + Intronic
917079296 1:171239737-171239759 AGATAAAAAAAGATAAAGAAGGG + Intergenic
917418873 1:174840830-174840852 AAAAAAAAAAAGAAGAAGAAGGG + Intronic
917962622 1:180156434-180156456 AAATACCAACAGTGGAACAATGG - Intronic
918340267 1:183562829-183562851 AAAAAAAAAAAGGTGAAGAATGG + Intronic
918366551 1:183814099-183814121 GAATAAAAACAGAGGAAGAAAGG + Intronic
918608478 1:186458775-186458797 ATATGAGAAAAGATGAAGAATGG + Intronic
918616652 1:186551558-186551580 AAAAAACAACAGAGGAAGAAAGG - Intergenic
918667809 1:187173380-187173402 TTATAAGAACAGATGTAGAATGG - Intergenic
918677933 1:187312850-187312872 AAACAACAGCAGATTAAAAATGG + Intergenic
918809449 1:189096646-189096668 AAATATCATTAGATGAAAAAAGG - Intergenic
919267181 1:195284650-195284672 AAAAAATAAGAAATGAAGAAAGG - Intergenic
919406913 1:197196726-197196748 AAATAACAGGAGATGAAGGTGGG - Intronic
920828081 1:209440676-209440698 AAAAAAAAAAAGATAAAGAAAGG + Intergenic
921145254 1:212349855-212349877 GAAAAACAAAAGATGAAGTAGGG + Intronic
921334349 1:214071374-214071396 AAAAAAAAAGAGAAGAAGAAGGG + Intergenic
921438860 1:215160009-215160031 AAATCACAAAAGATGAAAGAAGG + Intronic
921938148 1:220813469-220813491 AAATGACAACACTTGAAGCATGG + Exonic
921968012 1:221113937-221113959 TAATAGAAACAGATCAAGAAAGG - Intergenic
921985854 1:221311106-221311128 AAATAACAGCAGGGGAAGAATGG - Intergenic
922657079 1:227394820-227394842 AAGTAACAGCAGAAGAAAAAAGG - Intergenic
922692147 1:227702018-227702040 AAATAAAAAAAGACAAAGAAGGG + Intergenic
922965458 1:229687247-229687269 AAATAAAAAAAAATGTAGAAGGG - Intergenic
923074243 1:230595115-230595137 AAAAAAAAAAAGAAGAAGAAGGG + Intergenic
923299284 1:232626486-232626508 AAAGAACAGCAGCTGTAGAAGGG - Intergenic
923369033 1:233291618-233291640 AAAAAAAAAAAGAGGAAGAATGG + Intronic
923388688 1:233491942-233491964 AATTAAAAACAGAGAAAGAAAGG + Intergenic
923538860 1:234873929-234873951 AAAAAACAACAAAACAAGAACGG - Intergenic
923747501 1:236716088-236716110 AAAAAAAAAAAGAAGAAGAAGGG - Intronic
923889828 1:238201118-238201140 GAATGACAGCAGGTGAAGAAAGG - Intergenic
924189484 1:241535239-241535261 AAAAAAAAACAGAAGAAGATGGG - Intronic
1063335223 10:5206122-5206144 AAATTACAACAGATAACAAAAGG - Intronic
1063366864 10:5496299-5496321 AAATAACAAAAGAAAAATAAAGG - Intergenic
1063396742 10:5694920-5694942 AAATAATAACAGATCAATTAGGG - Intronic
1063453467 10:6166810-6166832 AAAAAAAAAAAGAAGAAGAAGGG - Intronic
1063682583 10:8203679-8203701 AAATAACAAGAGTTACAGAATGG + Intergenic
1064458711 10:15512538-15512560 AAAAAAAAAAAGAAGAAGAATGG - Intergenic
1064525279 10:16249671-16249693 AAATAAAAACAGAACAAGAAAGG + Intergenic
1064554271 10:16532915-16532937 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
1064577446 10:16760630-16760652 AAAATACAACAGATGGAGACAGG - Intronic
1064584595 10:16827596-16827618 AAATAACAAGAGAGTAAGTAAGG - Intronic
1064832970 10:19491972-19491994 AAAAAACAACCAATAAAGAAAGG - Intronic
1065302351 10:24334379-24334401 AAAGAAAAAAAGATGAAGGAAGG + Intronic
1065764123 10:29010702-29010724 AAATAAAAAAAGATAAATAATGG - Intergenic
1065878050 10:30014034-30014056 AAATAACATTAAAGGAAGAATGG - Exonic
1066125493 10:32337779-32337801 AAATAATAGAAGATGAAAAAGGG - Intronic
1067245066 10:44533901-44533923 AGATAAAAAGAGATAAAGAAGGG - Intergenic
1067350118 10:45468004-45468026 TAATTACAACATCTGAAGAAGGG - Intronic
1067656132 10:48192998-48193020 AAATAGCAGCAGAAAAAGAAAGG - Intronic
1068227382 10:54123514-54123536 AAACAACAACAGATGATGGGAGG + Intronic
1068437450 10:57010970-57010992 AGATAATAACAGAAGAAGCAAGG + Intergenic
1069053034 10:63814563-63814585 AAATAAAAAAAGACAAAGAAGGG - Intergenic
1069215693 10:65816229-65816251 AAAGAAGAGCAGATGAAAAAAGG + Intergenic
1070056658 10:72941557-72941579 AAAAAACAAAAGGTGAAAAATGG - Intronic
1070193470 10:74133658-74133680 AAAAAAAAAAAGAAGAAGAAAGG - Intronic
1071076983 10:81766861-81766883 AAATCACAACAGATGAAAAAGGG - Intergenic
1071253512 10:83844776-83844798 AAATGAGAACAGATGGACAAGGG - Intergenic
1071453957 10:85827681-85827703 AAAAAAAAAAAGATGAAGAACGG + Intronic
1071661817 10:87511664-87511686 AAAAAGCATCAGATGAAGACAGG - Intronic
1071878694 10:89870783-89870805 AAATTATAGCAGATGAAGAATGG + Intergenic
1072780550 10:98248399-98248421 AAATAACAACAGATGAAGAAAGG + Exonic
1073723102 10:106197612-106197634 AAAAAACAACAGAAGGAAAATGG - Intergenic
1074074758 10:110112804-110112826 ATTCAAGAACAGATGAAGAAAGG + Exonic
1074570017 10:114615821-114615843 AAAAAAAAACAGCTGAAGGAAGG + Intronic
1074634034 10:115293453-115293475 AAATAATAAGAGAGGAAGAAAGG - Intronic
1074757495 10:116635534-116635556 AAAAAAAAAAAGAAGAAGAAGGG - Intronic
1075058761 10:119239725-119239747 CAATAACAACACATGGACAAAGG - Intronic
1075317470 10:121464525-121464547 ATAGAACAACAAATGAGGAAGGG + Intergenic
1075612134 10:123862748-123862770 AAACAACGACAGATGCTGAAAGG + Intronic
1076325644 10:129619189-129619211 ACATTACAACAGATGCAAAAAGG - Intronic
1076925931 10:133487016-133487038 AAATAATAACAGATGAAGCAAGG - Intergenic
1077270972 11:1680799-1680821 AAATGATAAAAGAAGAAGAAAGG + Intergenic
1077346041 11:2054517-2054539 AAATAACATAAAAGGAAGAATGG - Intergenic
1077767311 11:5173381-5173403 ATATAAAAACAGAATAAGAACGG - Intronic
1078284289 11:9935688-9935710 CAAAAACAACAGATGGGGAAAGG + Intronic
1078627782 11:12973342-12973364 AAAAAAAAAAAGAAGAAGAAGGG + Intergenic
1078685953 11:13532429-13532451 AGATAAAAAAAGACGAAGAAGGG - Intergenic
1078768786 11:14327284-14327306 AAATAAAAATAGCTGAAGAGAGG + Intronic
1079067600 11:17310225-17310247 AAAAAAAAAAAGAAGAAGAAAGG - Intronic
1079279626 11:19075648-19075670 AAATGAGAACAGAGGCAGAATGG - Intergenic
1079460301 11:20672559-20672581 AAATAACAAGAACTGGAGAATGG - Intronic
1079512135 11:21223641-21223663 AAACAATAAGAGAAGAAGAAAGG - Intronic
1079654515 11:22971996-22972018 AAATAAAAAAAGACAAAGAAGGG - Intergenic
1079719757 11:23794990-23795012 AAAAAATAACAGAGGAAGGAAGG + Intergenic
1079746302 11:24135808-24135830 AAATAAAAGTAGATGAAGGAGGG - Intergenic
1080038555 11:27734899-27734921 AAAGAGCTACAGATGAAGGAAGG - Intergenic
1080343088 11:31291720-31291742 AAATAAGAGCAGATGAGGGAGGG - Intronic
1080382494 11:31788190-31788212 AAATAACAACTGACCAACAATGG + Exonic
1080864337 11:36180020-36180042 AAAAAACAACATATGTAAAATGG + Intronic
1081090411 11:38858462-38858484 AAAAAACAAAAGATCAAAAAAGG - Intergenic
1081333966 11:41841409-41841431 AAATAATAATACATGAAAAAGGG + Intergenic
1081944770 11:46981262-46981284 AAAAAAAAAAAGATGCAGAAAGG + Intronic
1082060057 11:47852216-47852238 AAATAATAACAGTTGAAGTGTGG - Intergenic
1082083596 11:48031151-48031173 AAATAACAAAAGATGAGGCTAGG - Intronic
1082179379 11:49100076-49100098 AAATATCAAAAGATGAACAATGG - Intergenic
1082216392 11:49575428-49575450 TAACAAAAACAAATGAAGAAAGG - Intergenic
1082694334 11:56341844-56341866 AAAAAAAAAAAGATGAGGAAAGG + Intergenic
1082872440 11:57955778-57955800 AAATGAAAGGAGATGAAGAAGGG - Intergenic
1083004907 11:59334811-59334833 AAATAACAAAAGAAAAATAAGGG + Intergenic
1083011111 11:59400445-59400467 AAAGAGTAGCAGATGAAGAATGG + Intergenic
1083873665 11:65508200-65508222 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
1084294175 11:68199885-68199907 AAATACCTGCAAATGAAGAATGG + Intronic
1084617642 11:70247031-70247053 AAAAAAAAAAAGAAGAAGAAGGG + Intergenic
1084805426 11:71575651-71575673 AAATAACAACAGAGAAAGGATGG - Intergenic
1085337307 11:75706063-75706085 AAAAGAAAGCAGATGAAGAAAGG + Intergenic
1085971343 11:81594985-81595007 AAATAATAACTGATGAAAACTGG + Intergenic
1086032486 11:82376873-82376895 AAAGAACATCAGAGGAAGACAGG + Intergenic
1086395794 11:86413659-86413681 CAATACCAGTAGATGAAGAAAGG + Intronic
1086633156 11:89048673-89048695 TAATAAAAACAAATGAAGAAAGG + Intronic
1086636356 11:89091778-89091800 AAACAATAAGAGAGGAAGAATGG + Intergenic
1086685905 11:89732843-89732865 AAATATCAGAAGATGAACAATGG + Intergenic
1087989838 11:104735215-104735237 GAATAAGAACAGATGAAGGAAGG + Intergenic
1088217939 11:107534746-107534768 AAAAAAAAAAAGATGAGGAATGG - Intronic
1089197766 11:116704797-116704819 AAATAAACAGAGAAGAAGAAAGG - Intergenic
1089962280 11:122626619-122626641 AAATAAGAACAAATGCAGTATGG - Intergenic
1090049963 11:123369439-123369461 AAATAAGAACAAATAAACAAAGG + Intergenic
1090357897 11:126152333-126152355 AAATTACAACAAATGTAGCATGG - Intergenic
1090638595 11:128710241-128710263 AAAAATGAAGAGATGAAGAAAGG + Intronic
1090675211 11:128986053-128986075 CAGCAGCAACAGATGAAGAAAGG - Exonic
1090911763 11:131127253-131127275 AAACAATAAGAGATCAAGAATGG - Intergenic
1091181378 11:133607484-133607506 AAATAACAACAGAGAGAGAGAGG + Intergenic
1091528918 12:1335463-1335485 TTATCACAACAGATGCAGAAAGG - Intronic
1091556300 12:1576125-1576147 AAATTACTGCAGATGAAGCAGGG + Intronic
1091782204 12:3220923-3220945 AAAGAGCAACGGATGAAGGATGG - Intronic
1091952051 12:4601447-4601469 AAACATCTACAAATGAAGAAGGG + Intronic
1092232461 12:6783817-6783839 AAATAAAAAAAGAAGAAGAAAGG - Intergenic
1092599666 12:10045725-10045747 AAATGACATCAAAGGAAGAAAGG - Intronic
1092663155 12:10761920-10761942 AGACATCAAGAGATGAAGAATGG - Intergenic
1092671170 12:10862374-10862396 AAACAATAAGAGAGGAAGAAAGG + Intronic
1093023901 12:14229313-14229335 AAACAATAAGAGAGGAAGAAAGG - Intergenic
1093162930 12:15770294-15770316 AAAAAAAAAAAGAAGAAGAAGGG + Intronic
1093342136 12:17990563-17990585 ATACAACAGCAAATGAAGAAAGG + Intergenic
1093689914 12:22099254-22099276 AAATCAAAACAGACAAAGAAGGG - Intronic
1093716499 12:22389207-22389229 ACATAATAAAAGAGGAAGAAGGG + Intronic
1093717218 12:22397111-22397133 AAATAAAAACAGATCAAGTTAGG + Intronic
1093916909 12:24813647-24813669 AATTCACACCAGATGAGGAATGG + Intronic
1094188609 12:27672736-27672758 AAATGAAAACTGATGAAGCAAGG - Intronic
1094235007 12:28153831-28153853 GAATTACAATAGATGAAAAATGG + Intronic
1094264216 12:28537577-28537599 AAATAACAACAGCATAAGCAAGG + Intronic
1094708519 12:32938106-32938128 AAATATCTACAGCTGCAGAATGG + Intergenic
1095237372 12:39813475-39813497 AAATAGTAACAGATGAAATATGG - Intronic
1095396142 12:41764597-41764619 AGATAACAAAAGAGGAACAAGGG + Intergenic
1095596294 12:43962532-43962554 TAAAAACAAAATATGAAGAAAGG + Intronic
1095671365 12:44864129-44864151 AGACAACAAGAGAGGAAGAAAGG + Intronic
1095832119 12:46599323-46599345 AAATAAAAAAAGACAAAGAAGGG - Intergenic
1096051491 12:48613333-48613355 AAATAAAAAAAGACAAAGAAGGG - Intergenic
1096275734 12:50206400-50206422 AAATAACATGAGACGGAGAAAGG - Intronic
1096829315 12:54301755-54301777 AAAAAAAAAAAGATGAATAAGGG - Intronic
1096933863 12:55247234-55247256 AAATTAGAACAGAAGAGGAAAGG - Exonic
1097453142 12:59760906-59760928 AAATAAAAAGACATGAAGCAAGG + Intronic
1097673244 12:62567252-62567274 AAATAATCACCAATGAAGAAAGG - Intronic
1097772359 12:63603016-63603038 AAACAAAAACAGATTCAGAAAGG + Intronic
1097806524 12:63970352-63970374 AGATAAGAACAGATGTAAAAGGG + Intronic
1097987428 12:65798730-65798752 AAAGAAGAACAAAGGAAGAAAGG + Intergenic
1098280772 12:68860875-68860897 AAAAAAAAAAAGAAGAAGAAAGG - Intronic
1098423864 12:70336568-70336590 AAATAACAGTATATGAAGAAGGG + Intronic
1098430542 12:70414765-70414787 AAATCTCAACAGTTTAAGAATGG - Intronic
1098506295 12:71255324-71255346 AAATAAAATCAGATGAAAGAAGG + Intronic
1098566702 12:71945313-71945335 AAATAAAAACAGATGTAAAAGGG - Intronic
1099446849 12:82762693-82762715 AAATAAAAACACAGGGAGAATGG + Intronic
1099951437 12:89308835-89308857 AAATAAAAAAAAAAGAAGAAAGG + Intergenic
1100073314 12:90748445-90748467 ACAAAACACCAGATGTAGAAAGG + Intergenic
1100443761 12:94642017-94642039 AAATAAATTCAGAAGAAGAATGG + Intronic
1100734775 12:97514184-97514206 AATTAACTACAGAGCAAGAATGG - Intergenic
1101250979 12:102935355-102935377 AGATAAAAACACATGAATAAAGG - Intronic
1101262258 12:103045218-103045240 AAATAAATACAGCTGAAGAACGG - Intergenic
1101342124 12:103851976-103851998 AAATAATAAAAGATCAAGAAAGG + Intergenic
1101470985 12:104996849-104996871 AAATAAAAAAAGACAAAGAAGGG - Intronic
1101994460 12:109514904-109514926 AAAAAAAAAAAGAAGAAGAAAGG - Intronic
1103307106 12:119973893-119973915 AAAAAAAAAGAGATGAAGGAAGG + Intergenic
1103771268 12:123327297-123327319 ATAAAACAACAGATGAAGCCAGG - Intronic
1104387372 12:128362973-128362995 AAATATCAAAAGATGAAGAGAGG + Intronic
1105384166 13:19914727-19914749 AATTTACAGCAGATGAAGAGTGG + Intergenic
1105967067 13:25394687-25394709 AAGAAACATCAGATGCAGAAAGG + Intronic
1106050633 13:26186763-26186785 AAAAAAAAAAAGAAGAAGAAAGG - Intronic
1107002998 13:35572933-35572955 AAACAACAAAATATGAAGTATGG + Intronic
1107131896 13:36905285-36905307 GAATTACAACAGAGAAAGAATGG - Intronic
1107262201 13:38506357-38506379 AAATCATAACAGAAGATGAAGGG - Intergenic
1107387210 13:39925005-39925027 AAACAACAAGAGAGGAAGAACGG - Intergenic
1108772499 13:53721390-53721412 AAACAAAAAGAAATGAAGAAAGG + Intergenic
1108827087 13:54425483-54425505 TATGTACAACAGATGAAGAAAGG - Intergenic
1108873887 13:55020773-55020795 AAACAATAAAAGCTGAAGAAAGG - Intergenic
1108956002 13:56157748-56157770 AAGCAACAAGAGAGGAAGAAAGG + Intergenic
1108958613 13:56191428-56191450 AAACAAAAAGAAATGAAGAAAGG - Intergenic
1109050975 13:57480962-57480984 AAATAAAAAGACATCAAGAAAGG + Intergenic
1109162959 13:58999279-58999301 AAATGTCAAAAGATGAAGAATGG + Intergenic
1109232538 13:59776236-59776258 AAATAGCAGCAGATGGAAAAGGG - Intronic
1109299384 13:60575185-60575207 AATTAAAAACAGAAGAAGGAAGG + Intergenic
1109403595 13:61868397-61868419 CAAAAACAACCAATGAAGAAAGG - Intergenic
1109535862 13:63718576-63718598 AGATAAAAAAAGATAAAGAAGGG + Intergenic
1109540239 13:63767710-63767732 AGATAAAAAAAGATAAAGAAGGG - Intergenic
1109579569 13:64309679-64309701 AAATAAAAACAGTAGAAGAAAGG + Intergenic
1109663098 13:65491605-65491627 CAATAACAAGAAATGAGGAAAGG + Intergenic
1109705617 13:66087700-66087722 AAATAAAATCAGTTGAAAAAAGG + Intergenic
1109771517 13:66980582-66980604 AAATAAAAACATATGAGAAAGGG - Intronic
1109824180 13:67696655-67696677 AAATTATAAAATATGAAGAACGG + Intergenic
1109861933 13:68211482-68211504 AAGGAACAAAAGATGGAGAATGG + Intergenic
1109999636 13:70178300-70178322 AATTAAAAAAAGATGAAAAAAGG - Intergenic
1110216394 13:73029343-73029365 AGATACCAACAGCTGAGGAAAGG + Intergenic
1110264211 13:73519531-73519553 AAAATACAACAGGAGAAGAATGG + Intergenic
1110630905 13:77707208-77707230 AAATAAAAACAGATTAGCAATGG - Intronic
1110748812 13:79088732-79088754 AAATAAAAAGAAAGGAAGAAGGG + Intergenic
1111206885 13:85021866-85021888 AAATAACAACATGTCAAGTAAGG - Intergenic
1111308186 13:86444639-86444661 AAATAAAAGCAGATGAAGTTTGG + Intergenic
1111400660 13:87730050-87730072 AAATAAGAAGAGCTGAAGCAAGG + Intergenic
1111473029 13:88709940-88709962 AAATGACAAGAAATCAAGAATGG + Intergenic
1111573306 13:90116535-90116557 AAACCACAATAGATAAAGAAGGG + Intergenic
1111718237 13:91908729-91908751 AAACATCAATAGATGCAGAATGG - Intronic
1111899597 13:94184632-94184654 AAAAAACAACAGATGCCGATTGG + Intronic
1112105656 13:96236564-96236586 AATAAATAACAGAAGAAGAAAGG - Intronic
1113136416 13:107095423-107095445 GAAAAAGAAGAGATGAAGAAGGG - Intergenic
1113341201 13:109427841-109427863 AAAGAACAAAAGAGGAAGAGGGG + Intergenic
1113847408 13:113400530-113400552 AAATAACTACAGCAGAAGAATGG - Intergenic
1114067499 14:19075778-19075800 AAAAAAAAAAAAATGAAGAATGG + Intergenic
1114094758 14:19324251-19324273 AAAAAAAAAAAAATGAAGAATGG - Intergenic
1114201008 14:20519783-20519805 AACTAACCACAGATCAAGAAAGG - Intergenic
1114274001 14:21125200-21125222 AAATAGCAAAAGTGGAAGAAAGG + Intergenic
1114376672 14:22153746-22153768 AAATAAGCACATATGGAGAATGG - Intergenic
1114856173 14:26447285-26447307 AACTTACAAATGATGAAGAATGG + Exonic
1114906683 14:27137149-27137171 AAATAACAATAGAGGTAAAAGGG - Intergenic
1115009876 14:28532878-28532900 CAATAGCAACCAATGAAGAAAGG - Intergenic
1115142121 14:30184065-30184087 AAATAAAAACAAAAGAAAAATGG + Intronic
1115303385 14:31909955-31909977 AGACAACAAGAGAGGAAGAAAGG - Intergenic
1115369226 14:32593253-32593275 CAATAAGGAGAGATGAAGAAGGG + Intronic
1115815240 14:37156333-37156355 AAATAATAAGAGAAAAAGAAAGG + Intronic
1116299701 14:43162420-43162442 AAATTACAACATCTGAGGAAAGG - Intergenic
1116457030 14:45132202-45132224 AAATAACAGCTGATGGGGAAAGG + Intronic
1116482171 14:45404634-45404656 AAAAAACAAAACATGAAAAAGGG - Intergenic
1116931093 14:50691789-50691811 CAACAACAACAGATAAAGATGGG - Intergenic
1117909310 14:60621419-60621441 AAAAAGAAACAGAAGAAGAAAGG + Intergenic
1118497160 14:66318518-66318540 AAACAATAAAAGAGGAAGAAAGG + Intergenic
1118504254 14:66393298-66393320 AAAAAAAAAAAGAAGAAGAATGG - Intergenic
1118926723 14:70197705-70197727 AGATAAAAAAAGATAAAGAAGGG - Intergenic
1119015087 14:71042799-71042821 AAACAATAAAAGAGGAAGAAAGG - Intronic
1119333780 14:73815321-73815343 AAAAAAAAAAAGAGGAAGAAGGG + Intergenic
1119486144 14:74988255-74988277 AAATCACATGAGATGAGGAAGGG + Intergenic
1119832540 14:77716332-77716354 AAACAACAACAAAAAAAGAATGG + Intronic
1119993187 14:79222854-79222876 AGAAAACAGCAGATGAAAAATGG - Intronic
1120002515 14:79318572-79318594 ACATGACAACAGCTGGAGAATGG - Intronic
1120074895 14:80145097-80145119 AAAAAACTAAAGAAGAAGAAGGG + Intergenic
1120430323 14:84404938-84404960 GAATCACAACAGATGAAACACGG + Intergenic
1120723605 14:87914347-87914369 AAATAAAAAAAGACAAAGAAGGG - Intronic
1120802376 14:88705398-88705420 AGATAACAACAGATGACTAACGG + Intronic
1120803514 14:88719930-88719952 ACATAACAACAAATGATAAAGGG + Intronic
1121696585 14:95918198-95918220 AAATAACACATCATGAAGAATGG + Intergenic
1121784556 14:96647300-96647322 AAACAAAAACAGAGAAAGAAAGG - Intergenic
1122419948 14:101569518-101569540 AAATAACCCCAGTTAAAGAAAGG + Intergenic
1122958200 14:105082492-105082514 AAATAACATAAGCTAAAGAAGGG - Intergenic
1123452997 15:20385011-20385033 AAAAATCATCAGATGAAGAACGG - Intergenic
1123455692 15:20422235-20422257 AAAAAACAACAGATGGTAAAGGG - Intergenic
1123839397 15:24232079-24232101 ACATAACAAAATATGAAAAAAGG - Intergenic
1123849269 15:24337886-24337908 ACATAACAAAATATGAAAAAAGG - Intergenic
1123852465 15:24373830-24373852 ACATAACAAAATATGAAAAAAGG - Intergenic
1123868329 15:24545391-24545413 ACATAACAAAATATGAAAAAAGG - Intergenic
1123879208 15:24659216-24659238 AAGTTATCACAGATGAAGAAGGG - Intergenic
1124690674 15:31819118-31819140 AAATAATAAGAGATTAAGGATGG + Intronic
1124723468 15:32133686-32133708 AATTCACAACAGATGAGGGAAGG + Intronic
1125025814 15:35027981-35028003 AAAAAAAAAAAGAAGAAGAAAGG - Intergenic
1125913504 15:43463433-43463455 AAGAAATAACAGATGAACAAGGG + Intronic
1126400872 15:48268684-48268706 AATTAATAACAGATGAAAAGAGG - Intronic
1126433289 15:48609624-48609646 AACCAACAACAGATGGAGAGTGG - Intronic
1127036604 15:54925203-54925225 AGATAGCAAGAGAGGAAGAACGG - Intergenic
1127334812 15:57973564-57973586 AAATAACTACAGCTGAAAAGGGG + Intronic
1127639457 15:60902155-60902177 AAATATCAATGGCTGAAGAATGG - Intronic
1127659573 15:61087591-61087613 TAAAAACAACATATGAGGAAGGG + Intronic
1127970149 15:63952264-63952286 AAAGAACAACGGAAGCAGAAAGG + Intronic
1128360925 15:66961183-66961205 AAATAACAACAAAAAAATAACGG + Intergenic
1128798945 15:70484870-70484892 AAATAATGAAAGATGAAGAGAGG + Intergenic
1128821472 15:70659375-70659397 AACAAACAAAAAATGAAGAAGGG - Intronic
1128954440 15:71925463-71925485 AAATAGTAAGAGAGGAAGAAAGG - Intronic
1128957105 15:71959853-71959875 AAAAAAAAAAAGATGAAGTATGG + Intronic
1129638028 15:77343398-77343420 AAAAGACAACCTATGAAGAATGG - Intronic
1129649596 15:77473928-77473950 AAATAAAAATGGATGAAGTAAGG - Intronic
1129812477 15:78521971-78521993 AAAAAAAAAAAGAAGAAGAAAGG - Intronic
1130695657 15:86128696-86128718 AAAGAAAAAGAGATAAAGAAAGG - Intergenic
1130763577 15:86846941-86846963 AAGTAATAACAGATAAAAAATGG - Intronic
1130824577 15:87531036-87531058 AAATGAAAACAGAAAAAGAAGGG - Intergenic
1130861480 15:87894698-87894720 ACATACCAACAGTTGGAGAAGGG - Intronic
1130978346 15:88794508-88794530 AAAAAAAAAAAGAAGAAGAATGG - Intergenic
1131005059 15:88971191-88971213 AAAAAAAAAAAGAAGAAGAAGGG + Intergenic
1131373809 15:91907200-91907222 AGAAAACAACAGAAAAAGAAAGG - Intronic
1131619827 15:94056160-94056182 AAATAACACCATTTGAAGACAGG + Intergenic
1131660330 15:94507361-94507383 AAACAATAAGAGAGGAAGAAGGG + Intergenic
1131896301 15:97034448-97034470 AAATAAAAAGAAATGAAGTATGG + Intergenic
1131896564 15:97038055-97038077 AAATCACACCATATTAAGAATGG + Intergenic
1131919801 15:97312553-97312575 AAATAACATTAAATGAAGAAAGG - Intergenic
1132029325 15:98427527-98427549 AAAAAACTACAGATGAAAATGGG + Intergenic
1133144371 16:3773201-3773223 AACTAACAAAAGAGGAAAAAAGG + Intronic
1133418782 16:5627599-5627621 AAATAACAACAAACTAAGAAGGG + Intergenic
1133519564 16:6543852-6543874 AAAAACCAAAAGAAGAAGAAGGG + Intronic
1133570244 16:7033641-7033663 AAACAAAAGCAGATGAGGAAGGG + Intronic
1134270435 16:12728411-12728433 AAAGCAAAAGAGATGAAGAAAGG + Intronic
1134272665 16:12747072-12747094 AAAAAAAAAAAGAAGAAGAATGG + Intronic
1135534467 16:23282468-23282490 AAATAAGTACAGATAAAGAAAGG + Intronic
1135682946 16:24473978-24474000 AAAAAATAACATATGCAGAATGG - Intergenic
1135737015 16:24939894-24939916 AAAAAACAGCAGAGGAAGTATGG - Intronic
1135941899 16:26829121-26829143 AAATAACAACACATAATTAAAGG + Intergenic
1137325086 16:47425946-47425968 AAACAATAAGAGATAAAGAAAGG - Intronic
1137346939 16:47671185-47671207 TAATAATGACAGATGGAGAAAGG - Intronic
1137358987 16:47795332-47795354 AGACAACAAGAGAGGAAGAAAGG - Intergenic
1137407266 16:48199436-48199458 AAAAAGAAACAGAAGAAGAAGGG + Intronic
1137973481 16:53009515-53009537 AGATAGCAAGAGAGGAAGAAAGG - Intergenic
1137991876 16:53165312-53165334 CAATTACAAAAGGTGAAGAAAGG + Intronic
1138776719 16:59731809-59731831 AAATAAAAAAAGACAAAGAAGGG + Intronic
1139240014 16:65381578-65381600 AAACAACAACAAAAGGAGAAGGG + Intergenic
1139388795 16:66592217-66592239 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
1139482783 16:67239904-67239926 TAATAAACACAGATGAGGAAGGG + Intronic
1140052929 16:71498852-71498874 AAAAAAAAAAAGATGAAGTAGGG - Intronic
1140155048 16:72415900-72415922 AAATAACAGCAGAAAAATAATGG - Intergenic
1140490742 16:75333796-75333818 AAGTAAAAAAAGATGAAGAAAGG + Intronic
1140771043 16:78204347-78204369 AAATAATCACATATGAAGAATGG + Intronic
1141130561 16:81433554-81433576 AAATAAAAAAAGATGAGGAAGGG - Intergenic
1141367686 16:83458254-83458276 AAACAATAACAGATCAACAAAGG - Intronic
1142862302 17:2770084-2770106 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
1143194977 17:5069175-5069197 AAAAAAAAAAAGAAGAAGAAGGG - Intergenic
1144212642 17:13028091-13028113 AAATAAGATTATATGAAGAATGG - Intergenic
1145726118 17:27126444-27126466 GAAAAAGAAAAGATGAAGAAAGG + Intergenic
1146040151 17:29445201-29445223 CAATAAGCACATATGAAGAATGG + Intronic
1147026912 17:37594451-37594473 AAAAAAAAAAAGAAGAAGAAAGG - Intronic
1147028829 17:37613469-37613491 AAATCACAGAAAATGAAGAAAGG + Exonic
1147197044 17:38773983-38774005 AAATAATGTCAGATGATGAAAGG + Intronic
1147743568 17:42682010-42682032 AAAAAAAAAAAGAAGAAGAAAGG + Intronic
1147748962 17:42715645-42715667 AAAAAACAACAGATGAATCCAGG + Intronic
1148745780 17:49917270-49917292 AAAAAAAAAAAGAAGAAGAAAGG - Intergenic
1148864456 17:50621255-50621277 AAAAAAAAAAAAATGAAGAAAGG - Intronic
1149324071 17:55511870-55511892 ACATGGCAACAAATGAAGAAAGG - Intergenic
1149560540 17:57605061-57605083 AAATGGCAACAGAAGCAGAATGG - Intronic
1149626200 17:58082818-58082840 AAAGAACAAAGGAGGAAGAAGGG + Intergenic
1149798529 17:59544408-59544430 AAAAAAAAAAAGAAGAAGAAAGG - Intergenic
1149819013 17:59756307-59756329 AAACAAAAAAAGATGAAAAATGG - Intronic
1150509920 17:65739817-65739839 AAGAAACAACAGATGAAGTAAGG - Intronic
1150948576 17:69775744-69775766 TAAAAATAACAGATGAAGTAGGG - Intergenic
1151302125 17:73234212-73234234 AAAGAATAAGAGATGTAGAAAGG + Intronic
1152856103 17:82665247-82665269 AAAAAAAAAAAGAAGAAGAAAGG - Intronic
1153079266 18:1201980-1202002 CAATAACAACAGAGAAAGATTGG - Intergenic
1153471878 18:5455641-5455663 AAATTACAACAAATGAAGGCAGG - Intronic
1153558367 18:6342643-6342665 AAATGGCAACAGAGGAAGAAAGG + Intronic
1154147284 18:11876723-11876745 AAGAAACAAAAGATTAAGAAGGG - Intronic
1154283438 18:13029092-13029114 AAATAACAACTGCTGAAAAGGGG - Intronic
1155109066 18:22696190-22696212 AAATATCAAATGATAAAGAAAGG - Intergenic
1155130498 18:22929877-22929899 AAATAAAAAGAGCTGAACAAAGG + Intronic
1155486391 18:26347489-26347511 AAATACTAAAAGATGAAGAAAGG + Intronic
1155748806 18:29394173-29394195 AAGTAATAACTGAGGAAGAAGGG + Intergenic
1155824489 18:30422300-30422322 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
1156685069 18:39634756-39634778 AAAAAAAAAAAAATGAAGAAAGG - Intergenic
1156778697 18:40824042-40824064 AGATCAAAAAAGATGAAGAAAGG + Intergenic
1156797349 18:41062794-41062816 AAAGAAGAAGAAATGAAGAAAGG - Intergenic
1157030335 18:43898762-43898784 AAATAATAAGATATGAAGAGTGG - Intergenic
1157086938 18:44590211-44590233 TAATAACAGCAGAAGAATAAAGG - Intergenic
1157472059 18:47997159-47997181 TAATAATAATAGAAGAAGAAAGG - Intergenic
1158391295 18:57047364-57047386 AAATTACTACAGAGGAATAAGGG + Intergenic
1158497714 18:57971288-57971310 AAATAACCACCAAAGAAGAAAGG - Intergenic
1158907569 18:62028811-62028833 AATTATCATCAGAGGAAGAAAGG + Intergenic
1159191674 18:65053204-65053226 AAAAAAAAACAAAAGAAGAAAGG + Intergenic
1159227185 18:65555003-65555025 AAATAGCAGGAGAAGAAGAAAGG + Intergenic
1159326057 18:66919473-66919495 AAATAACAACAGACCTAGAGAGG - Intergenic
1159360207 18:67390788-67390810 AAAAAATATCAAATGAAGAATGG + Intergenic
1159390143 18:67781996-67782018 CAATAATACCAGTTGAAGAAGGG - Intergenic
1159688119 18:71449105-71449127 AAATGACATCAGAGAAAGAATGG - Intergenic
1159772680 18:72565704-72565726 AAATAACAAAAGAGGATGAGAGG + Intronic
1160068436 18:75601122-75601144 AAACAATAAGAGAGGAAGAAAGG + Intergenic
1160094906 18:75862385-75862407 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
1160167799 18:76529415-76529437 AAATAACGAAGAATGAAGAAAGG - Intergenic
1160931440 19:1571922-1571944 AAAAAACATCAGATGCAGAGTGG - Intergenic
1162680133 19:12334188-12334210 AAATAAAAACAAGTCAAGAACGG + Intergenic
1163048348 19:14661917-14661939 AAACAACAACAGAGGAAGGAAGG + Intronic
1163456637 19:17410160-17410182 AAATAAAAAAAGAAAAAGAATGG - Intronic
1163537124 19:17883414-17883436 AAAAAAAAAAAGAAGAAGAAAGG + Intronic
1163688869 19:18727587-18727609 AAAAAAAAAAAGAAGAAGAAAGG + Intronic
1163716203 19:18873846-18873868 AAAAAAAAAAAGAAGAAGAAGGG + Intronic
1164110535 19:22153244-22153266 CAAAAACAAGAAATGAAGAAAGG + Intergenic
1164848422 19:31456955-31456977 AAATAACAATAAATTAATAAAGG - Intergenic
1164999860 19:32752174-32752196 AAAAAAGAAAAAATGAAGAAGGG - Intronic
1166577735 19:43858716-43858738 AAATAATAAGAGAAGAAGTAAGG + Intergenic
1167918600 19:52762397-52762419 AAAAAACAAAAGCAGAAGAATGG - Intergenic
1167938246 19:52924547-52924569 AAAAAAAAAGAGATGAGGAAGGG - Intergenic
1168253265 19:55153226-55153248 AAATAACAACAAAAGAAGGTTGG - Intronic
1168568317 19:57442778-57442800 AAATAACAACAGGGAAGGAAAGG - Intronic
925255265 2:2479523-2479545 AAATAACAACAAAAGAACAATGG - Intergenic
925507021 2:4577924-4577946 AAATAACAGCATATTATGAAAGG + Intergenic
925770298 2:7275623-7275645 AAATAAAAAAAGAAAAAGAATGG - Intergenic
925859138 2:8158038-8158060 AAAGAAAAAAAGAAGAAGAAAGG + Intergenic
926039615 2:9662306-9662328 AAAAAAAAAAAGATGAATAATGG - Intergenic
926437967 2:12856656-12856678 AAACAAAAAGAGATGAGGAAAGG - Intergenic
926482311 2:13414417-13414439 AAAAATCATGAGATGAAGAACGG + Intergenic
926524725 2:13964744-13964766 AAATAACATCAGATTGAAAAAGG - Intergenic
926645537 2:15286600-15286622 AATTAACGACAGAAGTAGAAGGG - Intronic
926666665 2:15531899-15531921 AAATAATCAGAGATGGAGAATGG - Intronic
927092141 2:19720165-19720187 AAATAACAGCAGATGAGCCAAGG + Intergenic
927363515 2:22265857-22265879 AAATAACACCAGATGAAAATAGG - Intergenic
927734804 2:25510502-25510524 AAAAAAAAAAAGAAGAAGAAAGG - Intronic
927744672 2:25606832-25606854 AAACATCACCTGATGAAGAATGG + Intronic
928019273 2:27689089-27689111 ACAAAAAAACAGATGTAGAATGG - Intronic
928536371 2:32245325-32245347 AAAAAAAAACAGATGAATAGAGG + Intronic
928668927 2:33580467-33580489 AAAAAAAAAAAGAAGAAGAAAGG - Intergenic
929443140 2:41981423-41981445 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
929676337 2:43935097-43935119 AAATAATAAAAGATGAAGCAGGG - Intronic
929734618 2:44533801-44533823 AAACAATAAGAGATGAAGAAAGG + Intronic
930161237 2:48158143-48158165 AAATAATAAAAGAGGAAAAAAGG + Intergenic
930682921 2:54276709-54276731 AATTAACAAAAGATTATGAAAGG - Intronic
931397035 2:61896716-61896738 AAAAAACAGCAGATGCATAAAGG + Intronic
932034957 2:68235094-68235116 CAATGAGAACAGATAAAGAATGG + Intronic
932156279 2:69420781-69420803 CAACAAAAAGAGATGAAGAAAGG + Intronic
932319491 2:70811158-70811180 AAATGACAGCAGCTGAACAATGG - Intronic
932444315 2:71765619-71765641 ACATAAAAAAAGATAAAGAAAGG + Intergenic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
933478468 2:82822353-82822375 AAATAATGACAGATGAAGTAGGG + Intergenic
933498431 2:83081370-83081392 CAATAACCACGGAGGAAGAATGG + Intergenic
933543237 2:83675415-83675437 GAAGAACAAAAGAAGAAGAATGG - Intergenic
933547385 2:83731606-83731628 AGAGAAGAAGAGATGAAGAAAGG + Intergenic
933929947 2:87139913-87139935 AAAAAAAAAGAGATGGAGAAAGG - Intergenic
933978512 2:87531040-87531062 AAGTTATAACAGATGAAGATGGG - Intergenic
934001280 2:87715698-87715720 AAAAAAAAAGAGATGGAGAAAGG - Intergenic
934902946 2:98175592-98175614 ACATAACAACATGTGAACAATGG + Intronic
935431421 2:102980128-102980150 AAATGACTACAGATAATGAAAGG - Intergenic
935531782 2:104241504-104241526 AGACAACAAGAGAGGAAGAAAGG + Intergenic
935724733 2:106013626-106013648 AAAAAAAAAAAGAAGAAGAATGG - Intergenic
936315320 2:111419762-111419784 AAGTTATAACAGATGAAGATGGG + Intergenic
936362992 2:111823502-111823524 AAAAAAAAAGAGATGGAGAAAGG + Intronic
936725799 2:115313447-115313469 ATATAGCAACAGATGAAATATGG + Intronic
936782004 2:116044735-116044757 CAAAAACAAGCGATGAAGAAAGG + Intergenic
936830220 2:116635454-116635476 AAACAATAAGAGAGGAAGAAAGG + Intergenic
936999194 2:118448617-118448639 AAATATCAAAGCATGAAGAAGGG - Intergenic
937129046 2:119493630-119493652 AAAAAAAAAAAGAAGAAGAATGG - Intronic
937444092 2:121941983-121942005 AAAAAATAAAAGAAGAAGAAGGG - Intergenic
937539603 2:122932784-122932806 TAATAAGAACAGATGCATAAAGG + Intergenic
937648892 2:124298128-124298150 AAATAAGAAAAAAGGAAGAAGGG - Intronic
937766597 2:125668355-125668377 AAATAACCGCAGAAAAAGAAAGG + Intergenic
937786715 2:125907552-125907574 ATATAAAAACATATTAAGAATGG + Intergenic
938272430 2:129985463-129985485 AAATAACAAATAATGAACAAAGG - Intergenic
938393138 2:130920740-130920762 AAACAACAAAATATTAAGAATGG - Intronic
938421219 2:131148306-131148328 AAATAAGAGCATTTGAAGAAAGG - Intronic
938550063 2:132371885-132371907 AAAGAAAAGAAGATGAAGAAGGG + Intergenic
938555700 2:132422164-132422186 AAATAACAAAGAATGAAGAGAGG - Intronic
938665020 2:133526123-133526145 AAAGAAAAACAAAAGAAGAAGGG + Intronic
938870050 2:135466075-135466097 AAAACACAATATATGAAGAATGG + Intronic
939145483 2:138409661-138409683 AGATAACAAGAGAGGAAGAAAGG - Intergenic
939276647 2:140006349-140006371 AAATAAAAAAAAAAGAAGAAAGG - Intergenic
939286660 2:140140156-140140178 AAATAACTAAAAATGTAGAAAGG + Intergenic
939782188 2:146463088-146463110 AGATAAAAAAAGATAAAGAAAGG - Intergenic
939851858 2:147313835-147313857 AAAGAATGACAGCTGAAGAAAGG + Intergenic
939889986 2:147724985-147725007 TAATAATGACAGAGGAAGAAAGG + Intergenic
940184519 2:150968710-150968732 AGAAAACAACAGAGGCAGAAAGG + Intergenic
940266127 2:151840904-151840926 AAATAATAATTGATGTAGAAAGG + Intronic
940406638 2:153311346-153311368 AAATATCCAAATATGAAGAAAGG + Intergenic
940432286 2:153606938-153606960 ATATGAAAAGAGATGAAGAATGG - Intergenic
940467204 2:154046162-154046184 AAATAAAAAAAGAAGAAGATGGG + Intronic
941059011 2:160824843-160824865 AAACAATAAGAGATGAAGAAAGG - Intergenic
941145793 2:161843505-161843527 AAATAATAACAGATATTGAAGGG + Intronic
941832347 2:169976244-169976266 AAACAATAAGAGAGGAAGAAAGG - Intronic
941861850 2:170290764-170290786 AAATAACCACAAAGGAAGACAGG - Intronic
942153235 2:173099636-173099658 AAATAATTACAGCTGAAGAATGG - Intronic
942181599 2:173385755-173385777 AAATAAAAACAGAAGAGGTAGGG + Intergenic
942407459 2:175670697-175670719 AAATAAAAAAAGACAAAGAAGGG + Intergenic
942616702 2:177798648-177798670 AAATGATATCTGATGAAGAAAGG + Intronic
942779573 2:179625518-179625540 ATATATAAACAGATGAATAAAGG + Intronic
942924324 2:181413511-181413533 AAATAAAAAAAGACAAAGAAGGG + Intergenic
943137993 2:183939687-183939709 AAACAATAAGAGAGGAAGAAAGG + Intergenic
943742524 2:191426025-191426047 AAGTCACAACCCATGAAGAATGG - Intergenic
944235368 2:197437229-197437251 AAACAACAATAGAGGAAGATTGG - Intergenic
944310875 2:198232607-198232629 AAAAAACAACAAAAAAAGAATGG - Intronic
944326049 2:198404939-198404961 CAATAAGAAGAGATGAAGAGGGG - Intronic
944601727 2:201309917-201309939 AAAAAAAAAAAGAAGAAGAAAGG + Intronic
944615928 2:201460129-201460151 AAATAAAGACAGCTGAAGATAGG - Intronic
944730164 2:202507688-202507710 AAAAAAAAAAAGATGAAAAAAGG - Intronic
944754476 2:202745517-202745539 AAACAATAAAAGAGGAAGAAAGG + Intronic
945066322 2:205950335-205950357 AAATAAAAACAAAGGAAGGAAGG + Intergenic
945179960 2:207081861-207081883 AAAAAAAAAAGGATGAAGAAGGG + Intronic
945300235 2:208209052-208209074 AAAAAAAAAAAGTTGAAGAAAGG + Intergenic
945346863 2:208728636-208728658 ATATCTCAATAGATGAAGAAAGG - Intronic
945665405 2:212735122-212735144 AAATGACAACAGAAAAAGCAAGG + Intergenic
946635911 2:221725434-221725456 AAACAATAAGAGAGGAAGAAAGG + Intergenic
946799142 2:223391586-223391608 AAAGAACATCAGATAAAGACAGG - Intergenic
947898209 2:233694992-233695014 AAATAGCTAGAAATGAAGAATGG - Intronic
948342092 2:237261725-237261747 AAGTAAAAACAAATGAACAATGG + Intergenic
948361625 2:237425344-237425366 GAATAAGAACAGATGAGAAAAGG - Intergenic
948713841 2:239846096-239846118 AAACAACAAGAGAGGAAGAAAGG - Intergenic
948997077 2:241586738-241586760 AATTAGACACAGATGAAGAAAGG + Intronic
1169099792 20:2937116-2937138 AAAAAAAAAAAGAAGAAGAAAGG - Intronic
1169534851 20:6526469-6526491 AAATAACAACAAAAGATGCAGGG - Intergenic
1169564975 20:6843968-6843990 AAATCACAAGAGAAGAAGAGCGG - Intergenic
1169720445 20:8670607-8670629 AAATAATAACACATGAAAACAGG + Intronic
1170050803 20:12143225-12143247 AAAAAATAAAAGATGAAGAAGGG - Intergenic
1170096606 20:12652203-12652225 CAATAATAACAGATGTAGAGAGG - Intergenic
1170169689 20:13396707-13396729 AAATATCAACAGAATGAGAAAGG + Intronic
1170290126 20:14760146-14760168 AAATAACAACTGCAGATGAAGGG + Intronic
1171200720 20:23239892-23239914 AAATAAAAAAAGACAAAGAAGGG - Intergenic
1171325109 20:24284268-24284290 AAACAATATCAGATGAAGGAAGG + Intergenic
1171939333 20:31309828-31309850 AGATAGCAAAAGAGGAAGAAAGG - Intergenic
1172275887 20:33678963-33678985 AAACCACAAAAGATGCAGAATGG + Intronic
1172653266 20:36520720-36520742 AAAAAAAAGCAGATAAAGAAGGG - Intronic
1172998167 20:39086083-39086105 AAATAAATAAAGATGAAAAAGGG - Intergenic
1173669072 20:44785219-44785241 AAAAAAAAAAAGAAGAAGAATGG - Intronic
1173709866 20:45145404-45145426 AAAAAACAACAGAAAAATAAGGG - Intergenic
1173711478 20:45160099-45160121 AGAAAACAAAAGAGGAAGAAAGG + Intergenic
1174394107 20:50235443-50235465 GAAAAAAAACAGATGAAAAATGG - Intergenic
1174884565 20:54318341-54318363 AAATAGCCATAGATGAAAAATGG - Intergenic
1174889246 20:54372696-54372718 AAATAATAAAAGAGGAAGAAAGG - Intergenic
1174906911 20:54561421-54561443 AAAGAACAAGAGACGAAGAAGGG - Intronic
1174954182 20:55078136-55078158 AAATAAAAACAGGTGAGAAAAGG - Intergenic
1175412477 20:58779605-58779627 AAAGAACAACAAATGTAGGACGG - Intergenic
1175548321 20:59796038-59796060 AAACAACAACAGAGGAAAAGAGG - Intronic
1175672170 20:60913141-60913163 AAGTAACTACAAATGAAGTAAGG + Intergenic
1176950805 21:15044118-15044140 AAATAAAAACAGATGAGTAGTGG - Intronic
1176956525 21:15110533-15110555 AAATACTAACAGATGCAGGAAGG - Intergenic
1176986108 21:15438525-15438547 AAAAAATAACAAATGAATAAAGG + Intergenic
1177028560 21:15953550-15953572 AAATAAGAAAAGATAAAGAAGGG - Intergenic
1177031791 21:15989350-15989372 AAATATCAAAAGATTAAGAATGG - Intergenic
1177035912 21:16042505-16042527 AAGCAACCACAGATTAAGAATGG - Intergenic
1177106683 21:16965332-16965354 AAATAATAAAAGAGAAAGAAAGG - Intergenic
1177114859 21:17073331-17073353 AAAAAAAAAAAGAAGAAGAAGGG + Intergenic
1177259938 21:18716663-18716685 AAACAAGAACAGAAGAAGGAAGG + Intergenic
1177551985 21:22635276-22635298 AAAAAAAAAAAGAAGAAGAAAGG - Intergenic
1177707854 21:24732386-24732408 AAATAAATACAGTTGCAGAAAGG - Intergenic
1177711933 21:24787675-24787697 AAATAACAACAGTAAAAAAAAGG - Intergenic
1178003255 21:28188277-28188299 AAATAAGCACTTATGAAGAATGG + Intergenic
1178013937 21:28320170-28320192 AAATAGCAAAAGAGGCAGAATGG - Intergenic
1178039325 21:28621933-28621955 AGATAAAAAAAGACGAAGAAGGG - Intergenic
1178052002 21:28758259-28758281 AGAAAACAACAGAACAAGAAAGG + Intergenic
1178055554 21:28794728-28794750 AAATAACCACTGAAGAACAATGG + Intergenic
1178110934 21:29369696-29369718 ACAGAACAAAAGATGGAGAAAGG + Intronic
1178164965 21:29963183-29963205 AAAGACAAACAGAGGAAGAATGG - Intergenic
1178312714 21:31542990-31543012 AAATAAAAACAGGTCCAGAAGGG + Intronic
1178526428 21:33333476-33333498 AAATAATAAGAGAGGAAGAAAGG + Intronic
1179091925 21:38274241-38274263 AGGCAACAAGAGATGAAGAAAGG - Intronic
1179282328 21:39944615-39944637 AGAGACAAACAGATGAAGAATGG + Intergenic
1180485974 22:15798345-15798367 AAAAAAAAAAAAATGAAGAATGG + Intergenic
1180669309 22:17540929-17540951 AAATAAAATCACATGAACAAAGG - Intronic
1181104020 22:20561712-20561734 TAAAAATAAAAGATGAAGAAAGG + Intronic
1181442928 22:22946928-22946950 AAATAAAAACAGAAGAAAGAAGG - Intergenic
1181693786 22:24582716-24582738 AAAAAACAAAAAATAAAGAAAGG - Intronic
1182579863 22:31300446-31300468 AAGGAATAAGAGATGAAGAAGGG + Intergenic
1182754597 22:32668577-32668599 CAACAACAACAAAGGAAGAAGGG - Intronic
1184416773 22:44356527-44356549 GAAAAACACCACATGAAGAAGGG + Intergenic
1184497890 22:44853303-44853325 AAATCACAGCAGATGATGTACGG - Intronic
1184634215 22:45813442-45813464 AAAAAAAAAGAAATGAAGAAAGG - Intronic
1185205348 22:49534967-49534989 AATTAAAAAAAGAGGAAGAAAGG - Intronic
949301578 3:2590246-2590268 AAACAACAAAAAAAGAAGAAAGG - Intronic
949369794 3:3322314-3322336 AAATATTAACATATGCAGAAAGG + Intergenic
949700669 3:6753606-6753628 AAATCACAAATGGTGAAGAAGGG + Intergenic
949796796 3:7860379-7860401 AAATAATCAGAGATTAAGAAAGG + Intergenic
949914415 3:8947299-8947321 AACAAACAACAGATGGAAAAAGG + Intronic
950764624 3:15264355-15264377 AATTACCAACAGATGCAAAATGG - Intronic
950975765 3:17242315-17242337 AAATAAACATAGAGGAAGAAAGG - Intronic
952027605 3:29101513-29101535 AAATAACAACAAAGACAGAATGG - Intergenic
952113150 3:30148045-30148067 TAATAACAACAGATGCAAAAAGG - Intergenic
952537668 3:34329407-34329429 ATAAAACAACAGATTAAAAATGG - Intergenic
952539797 3:34356017-34356039 AAATGGAAACAGATGGAGAATGG + Intergenic
952647300 3:35676179-35676201 CAATAAAAACATCTGAAGAAAGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953334408 3:42081436-42081458 AAATAACAACAAATGAAAGAAGG - Intronic
954279350 3:49565005-49565027 AAAGAAGAAAAGAAGAAGAAAGG + Intronic
954944069 3:54402195-54402217 AAAAAACAAGAGAGGGAGAAGGG + Intronic
954977354 3:54709000-54709022 AAAAAAAAAAAGATGAAGATGGG - Intronic
955263249 3:57416076-57416098 AAATAAAAATAGATCAAGCATGG - Intronic
955336746 3:58093097-58093119 AAATAACATAACATGAGGAAGGG - Intronic
955856247 3:63277115-63277137 GAAAAACAAAAGAAGAAGAAGGG - Intronic
956073274 3:65477518-65477540 CAATAACAACAGAAGAAACAAGG + Intronic
956291714 3:67667583-67667605 AAAAAAAAAAAGATGAAGATGGG + Intergenic
956655723 3:71548388-71548410 AAACAAAAACAGTTGAGGAAGGG - Intronic
956803665 3:72787451-72787473 AAATGACAAGGGATCAAGAACGG - Intronic
957345702 3:78958808-78958830 AAAAAAAAAAAGAAGAAGAAAGG - Intronic
957354942 3:79069940-79069962 AATTAATAAAAGATTAAGAAAGG - Intronic
957656095 3:83077801-83077823 AAATAAAAACACATTAAGCAAGG + Intergenic
957747203 3:84361187-84361209 AAAAAACAAGCGATGCAGAAAGG - Intergenic
957772267 3:84709010-84709032 AAATAAAAAAAGACAAAGAAGGG + Intergenic
958027703 3:88068202-88068224 AAATAAGCACTGATGAACAAAGG - Intronic
958030489 3:88103330-88103352 ACACATTAACAGATGAAGAATGG + Intronic
958129174 3:89395751-89395773 GAATAAGAACAGAGGGAGAAGGG - Intronic
958486221 3:94713382-94713404 AATACACAACAGAAGAAGAATGG - Intergenic
958705710 3:97652369-97652391 AAATAACAAGAGAGGTTGAATGG - Intronic
959449111 3:106477783-106477805 AGACAACAAGAGAGGAAGAAAGG - Intergenic
959641940 3:108648707-108648729 AAATAATCACTGATGAATAAAGG - Intronic
959664883 3:108910058-108910080 AAAGAACATCAGATAAAGGAAGG - Intronic
959679545 3:109077712-109077734 AAATAACAACAAAAGAAGCAAGG + Intronic
959857198 3:111173604-111173626 AAACAACAATAGAAGGAGAAAGG - Intronic
959905475 3:111706493-111706515 AAACAATAAAAGAAGAAGAAAGG + Intronic
961267412 3:125654754-125654776 AAATAACCAAAGATTTAGAAAGG - Intergenic
962153318 3:132916347-132916369 GAATAACAGAAGAAGAAGAAAGG - Intergenic
962239018 3:133734576-133734598 AAAACTAAACAGATGAAGAAAGG + Intergenic
962242640 3:133764144-133764166 AAATCACAGCAGATGAAAAGAGG - Intronic
962333243 3:134499809-134499831 AAAAAAAAAAAGATGAAGATGGG - Intronic
962450387 3:135510008-135510030 AAATAACAAGAAATGAAGCAAGG + Intergenic
962535014 3:136320341-136320363 AAATAAAAAAAGAAGAAAAATGG - Intronic
962841102 3:139233339-139233361 AAATAAAAACAGAGCCAGAAGGG - Intronic
963237134 3:142966933-142966955 AAATAAAAAGAAAAGAAGAAAGG + Intronic
963531943 3:146481958-146481980 CAAGAACAAAAAATGAAGAAAGG + Intronic
963548397 3:146690675-146690697 AAACAACAGGAGAGGAAGAAAGG - Intergenic
963879135 3:150507906-150507928 AAATAATAGGAGAGGAAGAAAGG + Intergenic
963884665 3:150568072-150568094 AATTAACAACTGATAAACAAAGG - Intronic
964659950 3:159109257-159109279 AAATTACCACAGTTGGAGAAAGG - Intronic
965028599 3:163334684-163334706 AAATAAAAAAAGATGTTGAATGG + Intergenic
965062741 3:163804041-163804063 ATATAATGACAGCTGAAGAAAGG + Intergenic
965191523 3:165536216-165536238 AGGTGACATCAGATGAAGAATGG + Intergenic
965750389 3:171969591-171969613 ACAAAACAACAAATGAACAATGG + Intergenic
966054579 3:175668789-175668811 GAATAACAAAAGACCAAGAAGGG + Intronic
966104155 3:176314849-176314871 AGATAAAAACAGCTGAAGACAGG + Intergenic
966570363 3:181435207-181435229 AAATAACAGCAGAAGAAACAGGG - Intergenic
966697675 3:182808865-182808887 AAATAACAACACATCAATATTGG - Intronic
966818712 3:183908858-183908880 AAAAAAAAAAAGAAGAAGAAGGG + Intergenic
967053908 3:185811195-185811217 AAATAATAACTGATGAAAAATGG + Intronic
967550837 3:190794061-190794083 AAATAACAACATAGAAGGAAAGG - Intergenic
967907062 3:194510116-194510138 AAAAAACAACAGATCAGGACAGG - Intergenic
967936838 3:194735449-194735471 AGACAGCAACAGAAGAAGAAAGG - Intergenic
969969029 4:11027112-11027134 AAAGAAAAAAAGAAGAAGAAAGG + Intergenic
970048905 4:11888421-11888443 AAAAAACAACACATCCAGAAAGG + Intergenic
970526067 4:16933403-16933425 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
970642508 4:18082770-18082792 AAATCTCAACAGATGGAGACAGG - Intergenic
970655161 4:18223066-18223088 AAATCAAAAGAGATGAAGAAGGG - Intergenic
970697796 4:18697942-18697964 AAAAAAAAACAGAAGCAGAAAGG - Intergenic
970851521 4:20609199-20609221 AAAGACAAAAAGATGAAGAAAGG - Intronic
970869744 4:20801749-20801771 AGACAACAAGAGAGGAAGAAAGG + Intronic
971034655 4:22679956-22679978 AAATAAGACCACATGAAGAGTGG - Intergenic
971132333 4:23826531-23826553 AAATTACAACACCTTAAGAAAGG + Intronic
971654008 4:29318076-29318098 AAAAAACAAGAAATGAGGAAAGG - Intergenic
971790926 4:31168955-31168977 AAAAAAAAAAAGAAGAAGAAAGG - Intergenic
971798916 4:31262965-31262987 AAAAAATAGCAGATGCAGAATGG + Intergenic
971881174 4:32375270-32375292 AAAAAATTAAAGATGAAGAAGGG - Intergenic
971950966 4:33345212-33345234 GAATAACAACAAAGGAAGAGAGG + Intergenic
972176679 4:36416883-36416905 AAATAACAAAAAATTAAAAAAGG - Intergenic
972184009 4:36506101-36506123 AAATAATATCAGATGAACTAAGG + Intergenic
972244947 4:37236302-37236324 ACATCACATCAGAAGAAGAAGGG - Intergenic
973323485 4:48833416-48833438 ACATTCCAACAGAGGAAGAAAGG + Exonic
973883077 4:55293181-55293203 AAATAACACCTGGTGAAGGATGG + Intergenic
974154514 4:58054094-58054116 AAGTAAAAACAGAAGAAAAATGG - Intergenic
974158863 4:58110846-58110868 AAAAAACAACAGATACAAAAAGG - Intergenic
974545179 4:63295813-63295835 AAATAAGAATAGATGGATAAAGG - Intergenic
974838865 4:67279843-67279865 ATATAATGACAGCTGAAGAAAGG - Intergenic
974901477 4:68004344-68004366 AGATAAAAACAGACAAAGAAGGG + Intergenic
975071804 4:70149702-70149724 AAAGAAAAAAAAATGAAGAAAGG + Intronic
975195130 4:71516041-71516063 AAATAATAAGAGAAAAAGAAAGG - Intronic
976040852 4:80883355-80883377 AAACAGCAAGAGAAGAAGAAAGG + Intronic
976276671 4:83285255-83285277 AAACAACAACAGAGAAATAACGG + Intergenic
976540283 4:86266145-86266167 AAGAAACAACAGAGGAAGAGAGG + Intronic
976540408 4:86267840-86267862 ATATAAAAACAGAAGAGGAAGGG - Intronic
976870281 4:89784193-89784215 AATAGAAAACAGATGAAGAAAGG + Intronic
976878340 4:89885992-89886014 AAATAAAAAAAGAAGAAGAAAGG - Intronic
976963675 4:91009576-91009598 AAATAACAAGAGAGTAATAAAGG - Intronic
977066554 4:92323707-92323729 AAATCACCAGAGAAGAAGAAAGG - Intronic
977084217 4:92574062-92574084 AAAGAACAAAAGACAAAGAAGGG - Intronic
977091875 4:92688026-92688048 AAAAAAAAAAAGAAGAAGAAGGG - Intronic
977190240 4:93991348-93991370 AAATTATAAAAGATAAAGAAAGG - Intergenic
977449971 4:97182852-97182874 TAACAACAACATATAAAGAAAGG - Intergenic
977526127 4:98147279-98147301 TCATATCAATAGATGAAGAAAGG + Intergenic
977728340 4:100323185-100323207 AAAAAAAAAAAGAAGAAGAAAGG - Intergenic
977830591 4:101587156-101587178 AAAAAAAAAAAGAAGAAGAAAGG + Intronic
978114018 4:104997503-104997525 AAAAAACAAGCGATGGAGAAAGG - Intergenic
978202679 4:106041246-106041268 AATTAATAACAGAATAAGAATGG + Intergenic
978706660 4:111721143-111721165 AAATAAAAACAAAACAAGAATGG - Intergenic
979174520 4:117646641-117646663 CAATAACAACCAATGAAGAAAGG - Intergenic
979286771 4:118934897-118934919 AAATAAACACCGATGAATAAAGG - Intronic
979421632 4:120511498-120511520 AAATAAAAAAAGACAAAGAAGGG + Intergenic
979442233 4:120764585-120764607 AAAAAAAAACAGTGGAAGAAAGG + Intronic
979884010 4:126001184-126001206 TAACAAGAACAGATGTAGAAGGG + Intergenic
980006273 4:127545626-127545648 AAATAAAAACTGATGGAGGAAGG + Intergenic
980023349 4:127735441-127735463 AAAAAACAATATATGAAGATTGG - Intronic
980092015 4:128453059-128453081 AAATAAAAATAACTGAAGAAAGG + Intergenic
980553168 4:134366995-134367017 AAATAAGACCATATGAAGCATGG - Intergenic
980623949 4:135346865-135346887 AAATAATAATAGAGAAAGAAAGG + Intergenic
980776597 4:137445114-137445136 AACTAACAGCAGATGAAGTAGGG - Intergenic
981178116 4:141706138-141706160 AAACAATAAAAGAGGAAGAAAGG - Intronic
981353068 4:143754426-143754448 AGATAAAAACAGACAAAGAAGGG + Intergenic
982244719 4:153340242-153340264 AAGAAAAAACAAATGAAGAATGG - Intergenic
982465358 4:155723613-155723635 AAATAAATGCAGAAGAAGAAGGG - Intronic
982790372 4:159585189-159585211 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
982850622 4:160310828-160310850 AAATAAACACAGCTGGAGAAAGG - Intergenic
983488822 4:168363768-168363790 AAACAACAAGAGAGGAATAAAGG + Intronic
983597037 4:169481164-169481186 AAATAGCAAGAGAAGTAGAATGG - Intronic
983830328 4:172318732-172318754 AAAAAACAACAAAAAAAGAAAGG + Intronic
983979029 4:173972033-173972055 AGACAGCAAGAGATGAAGAAAGG - Intergenic
984285824 4:177727362-177727384 AAATGAAAACAGAGGAAGAGAGG - Intergenic
984324327 4:178232143-178232165 AAATAGAAACAGATAAATAATGG + Intergenic
984449347 4:179879087-179879109 AAATAAGAACAGATTCAGGAAGG + Intergenic
984995001 4:185421974-185421996 AAAGAACATCAGAGGAGGAATGG - Intronic
985279565 4:188271797-188271819 AAAAAAAAAAAGAAGAAGAAGGG - Intergenic
985831392 5:2235354-2235376 AGATCAAAACAGATGAAGAAGGG - Intergenic
985919151 5:2955353-2955375 AAACAATAAGAGAAGAAGAAAGG - Intergenic
986298940 5:6463041-6463063 AAATAACAACATCAAAAGAAAGG - Intronic
986351249 5:6881676-6881698 AGATAACATGAGATGATGAAGGG + Intergenic
986589344 5:9353028-9353050 AAAGAACAAAAGAAGAAGGAAGG + Intronic
986897775 5:12391554-12391576 AAAGAATAAAAGATGAAGAGAGG - Intergenic
987015335 5:13812269-13812291 AAAGAATAAAAGATGAACAAAGG + Intronic
987332535 5:16869891-16869913 TAATAAAAACAGAAGGAGAAAGG + Intronic
987376366 5:17239081-17239103 AAAAAAAAACAGCTGAAGACAGG - Intronic
987638214 5:20575074-20575096 AAATAATAGCATATCAAGAAAGG - Intronic
987701138 5:21399896-21399918 ATTTATCAACAAATGAAGAAAGG + Intergenic
987837185 5:23177082-23177104 AGATAAACAAAGATGAAGAAGGG - Intergenic
987859895 5:23471160-23471182 ACATAGCAAGAGATGGAGAAAGG + Intergenic
988515601 5:31901420-31901442 AAAAAAAAAAAGAAGAAGAAAGG + Intronic
989533680 5:42538859-42538881 AAATAAGAAAATATGAACAAAGG - Intronic
989602007 5:43209100-43209122 AAATAAAAACAGAGGGAAAATGG + Intronic
989619885 5:43373689-43373711 AGATTATAAAAGATGAAGAAAGG - Intergenic
990011100 5:50999210-50999232 AAATAATCAAAGATGAAGAATGG - Intergenic
990236508 5:53773735-53773757 AAACAGCAAGAGAGGAAGAAAGG + Intergenic
990247019 5:53873313-53873335 AAATAAAAACAGATGAGGCTGGG - Intergenic
990360069 5:55009407-55009429 AGATCAAAAAAGATGAAGAAGGG + Intronic
990387908 5:55286263-55286285 AAAAAAGAACAGGTGAAGAAAGG + Intronic
990861019 5:60327463-60327485 GAATAACAGCAGATGCAAAAAGG - Intronic
991443229 5:66673357-66673379 ATCTAACAACAAAAGAAGAAAGG - Intronic
992386591 5:76290485-76290507 AAATAGAAAAAAATGAAGAATGG - Intronic
992462872 5:76978784-76978806 AAATAACAACAAATTTAGAATGG + Intronic
992745316 5:79814782-79814804 AAATGACAACAGCAAAAGAAAGG - Intergenic
992919804 5:81503157-81503179 AAAAAACAACAGATGCAGCTGGG + Intronic
993355360 5:86899990-86900012 AAATGAAATCAGATCAAGAAAGG - Intergenic
993527522 5:88984679-88984701 AAATAACAAATAGTGAAGAAAGG - Intergenic
993590000 5:89782666-89782688 GAAAAACAAGAAATGAAGAAAGG + Intergenic
993712282 5:91237615-91237637 AAATAACCAAAAATTAAGAAGGG + Intergenic
993761096 5:91798487-91798509 AAATCACAAGAGACAAAGAACGG - Intergenic
993979514 5:94528354-94528376 ATATAACAACAAATCAAGAGAGG - Intronic
994154192 5:96484393-96484415 ATTTAAAAACAGATGTAGAAGGG - Intergenic
994492672 5:100466873-100466895 AAACAACAAGAGATGAAGAAAGG - Intergenic
994573111 5:101538819-101538841 TAAAAACAAAAGAAGAAGAAAGG + Intergenic
994792341 5:104245422-104245444 AAATATCAAAAGAGGAAGACTGG + Intergenic
994849125 5:105031456-105031478 GAATAACAACATATTAGGAAGGG + Intergenic
994970722 5:106732995-106733017 AGATAAAAAATGATGAAGAAGGG + Intergenic
995004586 5:107176193-107176215 ACATACCAACATATGAACAATGG + Intergenic
995616584 5:113971254-113971276 AGATTTCATCAGATGAAGAAAGG - Intergenic
995617238 5:113978728-113978750 CAAAAACAAGAAATGAAGAAAGG - Intergenic
995830051 5:116345137-116345159 AAATAACAACAGAGGTTAAAAGG - Intronic
995854562 5:116577786-116577808 AAAAAAAAAAAGAAGAAGAAGGG - Intergenic
995891014 5:116950959-116950981 AAATAGGAAAAGATGAAAAAGGG + Intergenic
996297569 5:121940352-121940374 AAATTAAAACATATTAAGAAAGG - Intergenic
996306258 5:122051508-122051530 AAAAAAAAAAAGATAAAGAAGGG - Intronic
996389938 5:122948814-122948836 AATCCACAACACATGAAGAAAGG - Intronic
996469139 5:123839230-123839252 CAATAACAAAAGACAAAGAAGGG + Intergenic
996498012 5:124183950-124183972 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
996517267 5:124384941-124384963 AATTTACAAAAAATGAAGAAGGG + Intergenic
997014974 5:129922033-129922055 AAACAACAACTCATGAAGACGGG - Intronic
997252754 5:132402980-132403002 AAATAACAAGAAATGGGGAAAGG + Intergenic
997715907 5:136042635-136042657 AAAAAACAAAAGAGGAAGGAAGG + Intronic
997739625 5:136242258-136242280 AAATGACCACAGGTGAGGAAAGG - Intronic
998301220 5:141022639-141022661 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
998389678 5:141779509-141779531 AAGTAACAACAGCTTTAGAAGGG - Intergenic
998615966 5:143740887-143740909 AAATAAGAATAGAGGAAGGAAGG + Intergenic
998658309 5:144206688-144206710 AAATAGCAGCAGCAGAAGAAAGG + Exonic
998767540 5:145504664-145504686 AAATGAGATCAGATGAGGAAGGG - Intronic
998808634 5:145943144-145943166 AAATAACAAAAGAGTAACAATGG + Intronic
998949454 5:147377559-147377581 AAATAGCAAACCATGAAGAAAGG - Intronic
998951231 5:147394844-147394866 AAATTACAGCATATGAGGAAAGG - Intronic
999117788 5:149178988-149179010 AAAGAACAACAGATGAGAGAGGG + Intronic
999293090 5:150440440-150440462 AAAAAAAAAAAGAAGAAGAAAGG - Intergenic
999352126 5:150882287-150882309 AGATAGCAAGAGAGGAAGAAAGG + Intronic
999485945 5:151996229-151996251 AAATAATAAGAGAGAAAGAAAGG - Intergenic
999599909 5:153251182-153251204 AGATAGCAAGAGAGGAAGAAAGG - Intergenic
999602815 5:153285317-153285339 AAATCAAAACAGACAAAGAAGGG + Intergenic
999782315 5:154859177-154859199 AAACAAAAACAGAAGAAGAATGG + Intronic
999847499 5:155500691-155500713 CAATAACAACAAAAAAAGAATGG + Intergenic
1000046517 5:157526255-157526277 CAGTAATAACAGATGGAGAATGG + Intronic
1000073043 5:157758844-157758866 TAATAACAAGTGATTAAGAAAGG + Exonic
1000139302 5:158385970-158385992 AAATAAAAACAGATGAGAGAAGG - Intergenic
1000834675 5:166139301-166139323 AAATAAAATTAGAAGAAGAAAGG + Intergenic
1001323807 5:170704725-170704747 AAAAAACAAGAGGTGAAGAGTGG - Intronic
1001916181 5:175562011-175562033 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
1001941380 5:175742159-175742181 AAAAAAAAAAAGAAGAAGAAGGG + Intergenic
1002399610 5:178984319-178984341 AAATAACAGCAAATGAGCAAAGG + Intronic
1002504978 5:179673090-179673112 AAAAAAAAAAAGAAGAAGAAAGG - Intergenic
1002626517 5:180533392-180533414 TAATAACAATAAATTAAGAAAGG - Intronic
1003102770 6:3189914-3189936 AAATAACAGCAGATCAAGGGAGG + Intergenic
1003739888 6:8924699-8924721 AAAAAAGAAAAGAAGAAGAAAGG - Intergenic
1003755493 6:9114806-9114828 AAAGAACAAGTGATGCAGAAAGG + Intergenic
1004116849 6:12777614-12777636 AAAAAAAAAAAGAAGAAGAAAGG - Intronic
1004160335 6:13207272-13207294 AAATAAGAAAAGATGAGGACTGG + Intronic
1004840218 6:19575634-19575656 CAAAAACAACAAATGAGGAAAGG + Intergenic
1004984953 6:21070997-21071019 GATTAAAAACAAATGAAGAAAGG - Intronic
1005125248 6:22439517-22439539 AAAAAAAAACAGAAAAAGAAAGG - Intergenic
1005518762 6:26579720-26579742 AAATAACAAGCAATGAAGAATGG - Intergenic
1005529957 6:26693269-26693291 AAACAGCAAGAGAGGAAGAAAGG + Intergenic
1005540839 6:26808378-26808400 AAACAGCAAGAGAGGAAGAAAGG - Intergenic
1005665541 6:28049882-28049904 AAATTACAACACATGAAAAGAGG + Intergenic
1005950966 6:30630947-30630969 AAAAAAAAACAGAAAAAGAAGGG + Intronic
1006252905 6:32805424-32805446 AGATCAAAAAAGATGAAGAAGGG - Intergenic
1006315642 6:33289899-33289921 AAATATCAACAGCTACAGAAGGG + Exonic
1006469570 6:34220009-34220031 AAAAAAAAAAAGAGGAAGAAAGG + Intergenic
1006744927 6:36334804-36334826 AAACAAAAAAAGAAGAAGAAAGG - Intronic
1006882497 6:37352528-37352550 AAAAAAAAAGAGAGGAAGAAGGG + Intergenic
1007714324 6:43845751-43845773 AAATAAAAACAGATGAAAGCTGG + Intergenic
1007876145 6:45103622-45103644 ACAAAACAACAGAAGAAAAAGGG + Intronic
1008238707 6:49081853-49081875 AGATAACAAGAGAGAAAGAAAGG - Intergenic
1008280899 6:49594815-49594837 AAATAGTAAAAGATTAAGAAGGG + Intergenic
1008367297 6:50697401-50697423 AAACAAAAACAAAAGAAGAATGG + Intergenic
1008607002 6:53150283-53150305 AAAAAAAAAAAGATGAAGCAGGG - Intergenic
1008622191 6:53281518-53281540 ATTCAAAAACAGATGAAGAAGGG - Intronic
1008629805 6:53352496-53352518 AAATTAGAACAGAAGAAAAAAGG - Intergenic
1008812489 6:55520723-55520745 AAATAAAACCAGATGTAGAAAGG - Intronic
1008899671 6:56596620-56596642 AAATTAAACCAGAAGAAGAATGG - Intronic
1008901369 6:56621002-56621024 AATTTACAACAGATGAGGAAAGG + Intronic
1008964645 6:57301824-57301846 TAACAACAACAGAAAAAGAATGG + Intergenic
1009291098 6:61883549-61883571 AAATAACACTAGAAGAAGGATGG + Intronic
1009408662 6:63339751-63339773 AAACAATAAAAGAGGAAGAAAGG - Intergenic
1009412540 6:63382876-63382898 AAGTTACAACAGTTCAAGAATGG + Intergenic
1009702231 6:67199951-67199973 AAATAACCTCTGTTGAAGAATGG + Intergenic
1009762843 6:68030092-68030114 AACAAACAAAACATGAAGAATGG - Intergenic
1009810308 6:68653915-68653937 AAATAACAAAGGAGGAAGAGAGG - Intronic
1009874355 6:69486548-69486570 AAACAACAACAGAACAAAAATGG + Intergenic
1010013042 6:71071845-71071867 ACAGAACAACAGAGGAAGTAGGG + Intergenic
1010093443 6:72011210-72011232 CAAAAACAAGAAATGAAGAAAGG + Intronic
1010157009 6:72806538-72806560 AAATAGCAACAGACGAAGTAAGG + Intronic
1010178103 6:73053131-73053153 AAATCAAAAAAGATAAAGAAAGG + Intronic
1010194441 6:73225252-73225274 AATAAAAAACAGATGAAGGAGGG + Intronic
1010484198 6:76390372-76390394 CAGTAACAACAGAATAAGAATGG - Intergenic
1010527333 6:76918659-76918681 AAATAAAAACAAAGGAAGACAGG + Intergenic
1010733353 6:79413776-79413798 AAATAAGAACAGATTCAGAGTGG - Intergenic
1010936835 6:81872005-81872027 AGATCAAAAAAGATGAAGAAGGG + Intergenic
1010965755 6:82205863-82205885 AAAAAATAACAGAGGAAGAGAGG + Intronic
1011452609 6:87510873-87510895 AAAAAAAAAAAGATGAAAAAAGG + Intronic
1011862393 6:91775964-91775986 CAATAACAAGCAATGAAGAAAGG + Intergenic
1011907038 6:92384284-92384306 AAATAAGAAAAGATAAACAAGGG + Intergenic
1012018334 6:93881935-93881957 AAAAAACAAGAAATGGAGAAAGG - Intergenic
1012397390 6:98814554-98814576 AAATAAAATAACATGAAGAAAGG + Intergenic
1012555690 6:100508666-100508688 AAAGAAGAACAGATGAGTAAGGG + Exonic
1012645487 6:101673762-101673784 AAGTAACTACAAATGAAGACTGG - Intronic
1012764693 6:103351932-103351954 AAAGGAAAACAAATGAAGAAAGG - Intergenic
1012938628 6:105394097-105394119 ACATAAAAACAGATTAAAAATGG + Intronic
1013655297 6:112240107-112240129 AAATGACAATAGAAAAAGAAAGG - Intronic
1013874461 6:114806321-114806343 AAATAAAAAAAGAAGAAGGAAGG - Intergenic
1013896305 6:115092462-115092484 AAATAAAAAAAGAAAAAGAAAGG + Intergenic
1013926252 6:115476279-115476301 CAAAAACAAGACATGAAGAAAGG - Intergenic
1013962708 6:115919726-115919748 AAAATATAACAGATGAAAAAGGG + Intergenic
1014132346 6:117848582-117848604 AAATCAGAAAAGATAAAGAAGGG + Intergenic
1014635109 6:123836114-123836136 AAATAACAAATGGTGGAGAAGGG + Intronic
1014855845 6:126399500-126399522 AAAGAAAAACAGATGTAAAATGG - Intergenic
1014855847 6:126399556-126399578 AAAGAAAAACAGATGTAAAATGG - Intergenic
1014966164 6:127754803-127754825 CAATAAAAACAGATGAGCAAAGG + Intronic
1015093639 6:129388487-129388509 GAATGACAACAGATAGAGAAAGG - Intronic
1015203441 6:130608178-130608200 AAAAAAGAACAGAAGTAGAAAGG + Intergenic
1015320989 6:131874532-131874554 AAAAAACAACAGATGTAGTAAGG + Intronic
1015380630 6:132563466-132563488 TAATACCAACAGAAGATGAAAGG - Intergenic
1015656517 6:135524926-135524948 AATTGACCACAGTTGAAGAAAGG - Intergenic
1015737011 6:136411714-136411736 AAAAAACATGAGATGAAGAGTGG + Intronic
1015841535 6:137482182-137482204 AAAAAACAACAGAAAAAGATGGG + Intergenic
1016128637 6:140437364-140437386 AAATAACATAAGACAAAGAAAGG - Intergenic
1016320485 6:142839209-142839231 AAATAACCACATATAATGAAAGG + Intronic
1016369917 6:143362737-143362759 AAGTCACACCAGATGAGGAATGG + Intergenic
1016664879 6:146627289-146627311 AAATAAGAACATATGACTAATGG - Intronic
1016678802 6:146804109-146804131 AGATGACAACAAATGAAAAAAGG + Intronic
1016793513 6:148092145-148092167 AAATAGCAAGAGAAGAAGAAAGG + Intergenic
1016983379 6:149874696-149874718 AAATAATAACAAAAGAAAAAAGG - Intergenic
1017322882 6:153113315-153113337 AAATAAAAAAAGACAAAGAAGGG + Intronic
1017492380 6:154955850-154955872 CAACAACAACAAAAGAAGAAAGG - Intronic
1017974211 6:159340461-159340483 AAATAAGAAGAGAGAAAGAAAGG + Intergenic
1018231707 6:161682060-161682082 AGATACCAAAAGAGGAAGAAAGG + Intronic
1018281344 6:162188796-162188818 AAATAACAAAACTAGAAGAATGG + Intronic
1018292412 6:162306202-162306224 ACATAACAAAAGATGTACAATGG + Intronic
1019554551 7:1622377-1622399 AAACAAAAACAAATGAAGAAAGG + Intergenic
1020533693 7:9366647-9366669 AAGTAAAAAGAGATAAAGAAGGG + Intergenic
1020617094 7:10472856-10472878 AAATAGCAACAGAACAAGAATGG + Intergenic
1020894606 7:13924057-13924079 AAATAAAATAAAATGAAGAATGG + Intronic
1021048873 7:15957423-15957445 AAAAAACAAGAAATGAGGAAAGG + Intergenic
1021501118 7:21333152-21333174 TAAAAACAACAGATGAACAATGG + Intergenic
1021852884 7:24825787-24825809 AAATAACAGAAAAGGAAGAAAGG + Intronic
1021974062 7:25994836-25994858 ATTTAACAAGAGAAGAAGAAAGG + Intergenic
1022133851 7:27429146-27429168 AAAAAAAAACTGAGGAAGAATGG + Intergenic
1022193664 7:28042436-28042458 AAATGGCAGCAGCTGAAGAATGG + Intronic
1022260447 7:28699166-28699188 AAAAAAAAAAAGAAGAAGAAAGG - Intronic
1022365871 7:29715622-29715644 AAATAAAAACAGATTCAGAAAGG - Intergenic
1022590151 7:31653870-31653892 AAGTAACAACAGAAGAGGGAAGG + Intronic
1022674741 7:32488702-32488724 AAAAAACAAAAGCTGAACAAAGG - Intronic
1022695025 7:32696625-32696647 AAATACAAACAGATTCAGAAAGG + Intergenic
1022918288 7:34983766-34983788 AAAGAAGAAGAGAGGAAGAATGG + Intronic
1022931928 7:35126729-35126751 AAACAAAAACAGATTCAGAAAGG + Intergenic
1022939652 7:35221312-35221334 AAATATCAAAAGAAAAAGAAAGG + Intronic
1023534627 7:41195162-41195184 ATAAAACAAAAGGTGAAGAAAGG - Intergenic
1023642048 7:42268979-42269001 CAATAACAACGTATGGAGAAGGG - Intergenic
1023947151 7:44812233-44812255 AAAAAAAAAAAGAAGAAGAACGG - Intronic
1024853346 7:53746513-53746535 AGATAACAAATGATAAAGAAGGG + Intergenic
1025039516 7:55628958-55628980 AAATAACAGCAGATTTAGAGTGG + Intergenic
1025840193 7:65139665-65139687 CAATAACCACAGAGGTAGAATGG + Intergenic
1025882870 7:65556300-65556322 CAATAACCACAGAGGTAGAATGG - Intergenic
1025890574 7:65646304-65646326 CAATAACCACAGAGGTAGAATGG + Intergenic
1026288895 7:68988167-68988189 AAATAACAAAATAAGAAAAAGGG + Intergenic
1026307049 7:69151361-69151383 AAAAAAAAAAAGAAGAAGAAAGG - Intergenic
1026379977 7:69789649-69789671 ATAGAACATCAGATGAAGTAGGG + Intronic
1026638882 7:72106944-72106966 AAAGAAAAAGAAATGAAGAAAGG + Intronic
1026710136 7:72730628-72730650 AAAGAAGAAAAGAAGAAGAAGGG + Intronic
1027458868 7:78426901-78426923 AAATAAAAACAGACAAATAATGG + Intronic
1027633060 7:80632267-80632289 AAAAAAAAACAGAACAAGAATGG + Intronic
1027737016 7:81945354-81945376 AAAGAAGAACTGATGAAGCAAGG + Intergenic
1028006860 7:85583326-85583348 TAATAATGACAGATGAAGTAGGG - Intergenic
1028029814 7:85896269-85896291 AATTAAAAACAAAGGAAGAATGG + Intergenic
1028238442 7:88389242-88389264 AAATAAGAATAGTAGAAGAAAGG - Intergenic
1028625991 7:92877607-92877629 AAACAGCAAGAGAGGAAGAAAGG + Intergenic
1028635201 7:92980725-92980747 AAATACCAGCATATGAATAACGG - Intergenic
1028699003 7:93754250-93754272 AAATAGCACCAGATGTGGAAGGG - Intronic
1029353466 7:100032415-100032437 AAATGACAACAGAGGGAGCATGG - Intronic
1029554998 7:101262730-101262752 AAAAAAAAAAAGAAGAAGAAGGG + Intergenic
1029574211 7:101392327-101392349 TCATAACAACAGATGGAAAAAGG - Intronic
1029827814 7:103219207-103219229 AAACAAAAACAGATTCAGAAAGG + Intergenic
1030058924 7:105607699-105607721 AATTAAAAAAAGAAGAAGAAAGG + Exonic
1030061704 7:105627220-105627242 AAATAAATACAGAAAAAGAAAGG - Intronic
1030443635 7:109621127-109621149 AAAAAACAATACATGAAGACAGG + Intergenic
1030733898 7:113021267-113021289 AAATAAGCACATATGGAGAATGG + Intergenic
1030811376 7:113976374-113976396 AAATAAGCACAGATGGAGAGTGG - Intronic
1031240579 7:119233300-119233322 AAATTAATACATATGAAGAAAGG + Intergenic
1031699472 7:124905362-124905384 CAATAACAAGAAATGGAGAAAGG + Intronic
1031845720 7:126804041-126804063 TAATCACAAAAGATGCAGAAGGG + Intronic
1031851914 7:126875703-126875725 CAATAACCACAGAGGTAGAATGG - Intronic
1032278466 7:130481429-130481451 AAAAAAAAAAAGAAGAAGAAAGG - Intergenic
1032437982 7:131917447-131917469 AAATTACCATAGATAAAGAAGGG + Intergenic
1032776565 7:135119880-135119902 AAATAAAAAAAGAAAAAGAAAGG + Intronic
1032779368 7:135151338-135151360 AAATAAAAAGGGAAGAAGAAAGG - Intronic
1032786033 7:135200283-135200305 AAATAAAAACAAAGGAAAAAGGG + Intronic
1033185282 7:139221912-139221934 AAAAAACAACAGACTAAGAAAGG - Intergenic
1033682776 7:143612095-143612117 TAAGAAGAAGAGATGAAGAAAGG - Intergenic
1033701837 7:143845548-143845570 TAAGAAGAAGAGATGAAGAAAGG + Intergenic
1033782037 7:144683174-144683196 AAAAAAAAAAAGATGCAGAAAGG - Intronic
1034035921 7:147821933-147821955 GAAAAATAACAGATTAAGAAGGG + Intronic
1034079207 7:148261147-148261169 GAAAAACAACAGATGCACAAAGG - Intronic
1034362393 7:150511816-150511838 AAATAATAACAGGAGATGAAAGG - Intergenic
1034381125 7:150693645-150693667 AATTAACAACATATGATCAAAGG - Intergenic
1034887506 7:154809255-154809277 AAAAAAAAAAAGAAGAAGAAGGG + Intronic
1035969520 8:4232185-4232207 AAATAAAAACAAATAAATAAAGG - Intronic
1036800586 8:11788070-11788092 ACAAAACAACACATGAAGACAGG + Intergenic
1037096701 8:14994589-14994611 AAAAAAAAAAAGAAGAAGAAAGG + Intronic
1037106309 8:15112273-15112295 AAATAGCAACAAATCATGAAGGG - Intronic
1037168864 8:15865434-15865456 AAACAACAAGAGAGGAAGAAAGG + Intergenic
1037214643 8:16433980-16434002 AAATCACATTATATGAAGAATGG + Intronic
1037269353 8:17109142-17109164 AAATAAAAACAGATTAAGGTAGG - Intronic
1038403947 8:27308032-27308054 AAGTGACAACAGATGCAGAACGG + Intronic
1038736882 8:30178095-30178117 AAAAGACAACACATGAATAATGG - Intronic
1038782294 8:30578606-30578628 AAGTAACAAACGAGGAAGAAAGG + Exonic
1039011105 8:33093679-33093701 AAAAAAAAGCAAATGAAGAAAGG + Intergenic
1039340023 8:36637544-36637566 AAATCACAACAGAAAAAAAACGG + Intergenic
1039343217 8:36673816-36673838 AAATAAAAACAGACAAACAATGG + Intergenic
1039409394 8:37340041-37340063 AAAAAAAAAAAAATGAAGAATGG + Intergenic
1040728397 8:50411489-50411511 AAATAAAAACAGAAGGAGGAAGG + Intronic
1040758694 8:50811650-50811672 AAAGAACAACAGAAGAGGAAAGG - Intergenic
1040762470 8:50866384-50866406 AAATTATAAAAGATTAAGAAAGG - Intergenic
1040899157 8:52400496-52400518 AGACAACAAAAGAGGAAGAAAGG - Intronic
1040960207 8:53023887-53023909 AATTAACAAGAGATGGAAAATGG + Intergenic
1041021161 8:53640461-53640483 AAATAAAAAAAGACAAAGAAGGG - Intergenic
1041178071 8:55218044-55218066 AAATAATAGGAGATGGAGAAAGG + Intronic
1041426458 8:57726239-57726261 AACTTACAACAGATGAAAAGAGG - Intergenic
1041563409 8:59247263-59247285 AATTAACAACTGTTGAAGAGGGG + Intergenic
1041959151 8:63592225-63592247 AAATAGCAACAGGGGAAGAAGGG - Intergenic
1041980076 8:63847401-63847423 AATTAAGAACAAATGAAGAGTGG + Intergenic
1042538621 8:69884943-69884965 AAAAAAAAAGAGAAGAAGAAGGG + Intergenic
1042973592 8:74438279-74438301 AAACAACAACAAAAAAAGAAGGG + Intronic
1043384489 8:79734570-79734592 AAGTAACAACATAAAAAGAATGG + Intergenic
1043603819 8:81974561-81974583 AAACAGCAACAGAGGAAGAAAGG - Intergenic
1043642774 8:82477157-82477179 AAAGAATATGAGATGAAGAAAGG - Intergenic
1044072588 8:87780408-87780430 AAACAAAAACAGAAAAAGAAAGG + Intergenic
1044366764 8:91357010-91357032 AAGTAAAACAAGATGAAGAATGG - Intronic
1044490978 8:92814461-92814483 ATATAACACATGATGAAGAAGGG + Intergenic
1044581126 8:93827363-93827385 AAATAAAATAAAATGAAGAAGGG - Intergenic
1044614639 8:94127138-94127160 AAATAAAAACAGAGGCAGAGCGG + Intergenic
1045151990 8:99418274-99418296 AAATAAGAAGAAAAGAAGAAAGG - Intronic
1045333183 8:101174700-101174722 AAGTAACAAGAGATGAAATATGG + Intergenic
1045831128 8:106461565-106461587 AAATAAAAACAAATAAATAAAGG + Intronic
1046159081 8:110335439-110335461 AAAGAACTACAGATTTAGAAAGG + Intergenic
1046288040 8:112120877-112120899 AAATATTAATATATGAAGAAGGG - Intergenic
1046688881 8:117260040-117260062 ACTTAACAACACAAGAAGAAAGG + Intergenic
1046699776 8:117387129-117387151 AAATTGCAACTGATGAAGAATGG + Intergenic
1046798777 8:118401530-118401552 AAAAAAAAAAAGAAGAAGAAGGG - Intronic
1047066086 8:121284641-121284663 AAATAAATAAAGAAGAAGAAAGG + Intergenic
1047068258 8:121312101-121312123 AGATAACAAGAGATGAATAAAGG - Intergenic
1047217811 8:122892500-122892522 AAACAATAAGAGAGGAAGAAAGG - Intronic
1047904964 8:129463104-129463126 AAAGACATACAGATGAAGAAAGG + Intergenic
1048171086 8:132107103-132107125 AAATAGATACAGAAGAAGAAGGG - Intronic
1048397097 8:134024222-134024244 ACAAAATAACAGATGAAGAGGGG - Intergenic
1048729563 8:137423285-137423307 AAAAAAAAATAGAGGAAGAAAGG - Intergenic
1048792093 8:138113499-138113521 AACAAACAATAAATGAAGAAGGG - Intergenic
1049085451 8:140474883-140474905 AAATAACATAAGATGGAGGAGGG + Intergenic
1049233937 8:141499480-141499502 AAATGACAACAGATGGAAATAGG + Intergenic
1050129914 9:2401465-2401487 AAATCAAAAAAGACGAAGAAGGG - Intergenic
1050241768 9:3643793-3643815 AAATAACAACAAAAGAAATAGGG + Intergenic
1050465694 9:5920823-5920845 AAATCAGAACAGATGATGCAAGG + Exonic
1051665926 9:19466855-19466877 AAACAAAAAAAGATGAAAAATGG - Intergenic
1051764332 9:20505899-20505921 ACGTAACAACAGCTGAAAAATGG - Intronic
1052249812 9:26384583-26384605 ATATAACTAAAGATGAAAAAAGG - Intergenic
1052771337 9:32693738-32693760 AAATAAGCACACATGGAGAATGG - Intergenic
1054101038 9:60948125-60948147 AAAAAAAAAAAGAAGAAGAAAGG - Intergenic
1055077936 9:72236508-72236530 AAATCCCAGCAGATGCAGAAAGG - Intronic
1055518663 9:77058737-77058759 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
1055562677 9:77536286-77536308 AAAAAACAACAGCAGAACAACGG + Intronic
1055643762 9:78343546-78343568 ATAAAACAAGACATGAAGAAGGG - Intergenic
1055931145 9:81560919-81560941 AAATAACATCAGAAAAAAAATGG + Intergenic
1055984768 9:82046650-82046672 AAATAGCAAGACAGGAAGAAAGG - Intergenic
1056275435 9:84990317-84990339 AAATGACATCAGAGGAAAAAAGG + Intronic
1056388661 9:86120119-86120141 AAAAAAAAAAAGACGAAGAAAGG + Intergenic
1056486528 9:87063639-87063661 AAAAAAAAAAAGATGAGGAAGGG - Intergenic
1057418865 9:94891826-94891848 AAATAATAACAGAAGAAGGTTGG - Intronic
1057823260 9:98351313-98351335 AAATAATAAAAGAGGAATAAAGG - Intronic
1057876058 9:98755425-98755447 AGATAAAGGCAGATGAAGAAAGG - Intronic
1058374551 9:104307319-104307341 AAATAAAAAAAGACAAAGAAGGG + Intergenic
1058461046 9:105183074-105183096 AAAAAACAACAGATGGGGAGAGG - Intergenic
1058538054 9:105982800-105982822 AAATCTCAAGAGATAAAGAAGGG - Intergenic
1058891562 9:109365720-109365742 AAATACAAACAAATAAAGAATGG - Intergenic
1059575329 9:115481994-115482016 GAAGAAAAACAGATGATGAATGG + Intergenic
1059592364 9:115675489-115675511 AAACAACAACCGAAAAAGAAAGG - Intergenic
1059848000 9:118303028-118303050 AAAAAACAGCAGGGGAAGAAGGG - Intergenic
1059873106 9:118600504-118600526 AAATAATAACAGATGAGAATGGG + Intergenic
1060674608 9:125502090-125502112 AAAAAAAAAAAGAAGAAGAAAGG - Intronic
1060707272 9:125815594-125815616 AAAGTACAACAGTTAAAGAAGGG - Intronic
1060776645 9:126379624-126379646 ATATAACAACAGGAAAAGAAAGG - Intronic
1060780251 9:126406821-126406843 AAAAAAAAAAAGATGAAGAAAGG - Intronic
1061047329 9:128173618-128173640 AAAACACAACAAATGAAGAAAGG + Intronic
1061459768 9:130727881-130727903 AAATAAAAACAAATTAAGAATGG + Intronic
1061849944 9:133408462-133408484 AAAAAAAAAAGGATGAAGAACGG + Intronic
1061979029 9:134089302-134089324 AAATAAAATAAGAAGAAGAAGGG + Intergenic
1062458449 9:136652235-136652257 AAATAATAACAAACAAAGAAAGG - Intergenic
1185953236 X:4459793-4459815 AAATAAGAAAAAATGAAAAAAGG + Intergenic
1186095066 X:6091895-6091917 AAAAAAGAACAAAGGAAGAAAGG - Intronic
1186144257 X:6609355-6609377 AAAATCCAATAGATGAAGAAAGG + Intergenic
1186431180 X:9505685-9505707 AAATAAAAACAGACAAAGAAGGG + Intronic
1186557554 X:10575827-10575849 AAGTAAGAACAGGTGAAAAAAGG + Intronic
1186590690 X:10926990-10927012 TAATAATAAGATATGAAGAATGG + Intergenic
1186686028 X:11925143-11925165 AAAAAAAAAAACATGAAGAAGGG + Intergenic
1186775206 X:12857646-12857668 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
1187680512 X:21762555-21762577 AAAAAATAACAGATGAAGAATGG + Intergenic
1187804363 X:23102104-23102126 AAATAAGGACGGAAGAAGAAAGG - Intergenic
1188376789 X:29441052-29441074 AGATAATAACAGAAGAAAAAAGG - Intronic
1188529721 X:31126343-31126365 AAATGGCAACAGATGATGAACGG + Intronic
1188681378 X:33011821-33011843 AAATAAAATCAGATAAATAATGG + Intronic
1188763175 X:34057277-34057299 AAACAATAACAGAGGAAAAAAGG + Intergenic
1188798680 X:34498770-34498792 AAATCTCAACAGATAAACAATGG - Intergenic
1188970334 X:36607333-36607355 AAATAAAGTCAGATGAAAAAGGG + Intergenic
1189308347 X:40004061-40004083 GCATAAAAACAGATGAAGAAAGG - Intergenic
1189314465 X:40044720-40044742 CAATAAAAATAGATGAATAAAGG - Intergenic
1189640441 X:43064165-43064187 AAATAACAACAGAGACAGAAAGG - Intergenic
1189888496 X:45575134-45575156 AAACAATAAAAGAGGAAGAAAGG - Intergenic
1189893483 X:45629640-45629662 AAATAACAACACCTGAAGCTGGG + Intergenic
1190038443 X:47049170-47049192 AAAAAAAAAAAGAAGAAGAAAGG - Intronic
1190075026 X:47310722-47310744 AAATAACACAAGATGGAGGAGGG - Intergenic
1190228873 X:48566063-48566085 AAAAACGAAAAGATGAAGAAAGG + Intergenic
1191093104 X:56645297-56645319 AGATAACAAAAGACAAAGAAGGG - Intergenic
1192075872 X:67995798-67995820 CAAAAACAAGAAATGAAGAAAGG - Intergenic
1192486693 X:71533555-71533577 AAATAAAAACAAAGCAAGAAAGG - Intronic
1192601689 X:72471226-72471248 AAATAACATCAACTGATGAATGG - Intronic
1192619556 X:72664004-72664026 AAACAATAAGAGAGGAAGAAAGG + Intronic
1192699350 X:73451246-73451268 AAACCAGAACAGATGATGAAGGG - Intronic
1193234776 X:79093327-79093349 ATATAACAAAAGGTGAAGGATGG + Intergenic
1193242805 X:79192771-79192793 AAATAAATAAAGATGAAAAAAGG - Intergenic
1193406839 X:81110851-81110873 AAATAAGACCTGAGGAAGAAAGG + Intergenic
1193497696 X:82234869-82234891 AGATCAAAAAAGATGAAGAAGGG - Intergenic
1193844321 X:86449566-86449588 AGACAATAAGAGATGAAGAAAGG - Intronic
1194101856 X:89716028-89716050 AAAAAAAAAAAGAAGAAGAAAGG + Intergenic
1194130163 X:90071950-90071972 AGATAACAACACAATAAGAATGG - Intergenic
1194171883 X:90596532-90596554 AAATAAAAAAAGACAAAGAAAGG - Intergenic
1194181713 X:90718013-90718035 AAGTAATAAAAAATGAAGAAAGG + Intergenic
1194759645 X:97780089-97780111 ATGTAACAACAGATGCAAAATGG + Intergenic
1195034847 X:100963172-100963194 AAATAAAAACATTTGAAAAAAGG + Intergenic
1195424079 X:104708049-104708071 GAATAACAACCCATGAGGAATGG + Intronic
1195486328 X:105411229-105411251 AAACAACAAGAGAGGAAGAAAGG + Intronic
1195568462 X:106372487-106372509 ATATCAAAAAAGATGAAGAAGGG + Intergenic
1195661135 X:107379776-107379798 AGATCAAAAAAGATGAAGAAGGG - Intergenic
1195722216 X:107878016-107878038 AAAAAAAAACAGCTGAAGAGAGG + Intronic
1195899916 X:109786887-109786909 AAATGACAACAGATCACTAAGGG + Intergenic
1195985819 X:110628702-110628724 AGATCAAAATAGATGAAGAAGGG + Intergenic
1196207223 X:112954660-112954682 AAAAAACAACAGCTGAAAGAAGG - Intergenic
1196260870 X:113579693-113579715 AAACAAGAACAGATTGAGAATGG + Intergenic
1196279435 X:113805638-113805660 AAATAAAAACAGATGAGAGATGG - Intergenic
1196284005 X:113858409-113858431 AAGAAACAACAGATGCTGAAGGG - Intergenic
1196293878 X:113977391-113977413 AAATAAAAACAAATAAATAAAGG + Intergenic
1196497531 X:116339038-116339060 CAATAACAAGCTATGAAGAAAGG + Intergenic
1197238804 X:124099888-124099910 AAGTAAAAGCAGATGATGAATGG - Intronic
1197269029 X:124405837-124405859 AAGGAAGAACAGAAGAAGAAAGG - Intronic
1197961978 X:132017028-132017050 AAAAAAAAAAAGAAGAAGAAGGG + Intergenic
1198661659 X:138975533-138975555 AAAAAAAAAAAGAAGAAGAAAGG + Intronic
1199027121 X:142953244-142953266 ATAAAAAAACAGATAAAGAAGGG - Intergenic
1199119477 X:144034526-144034548 AATTATCAACAGATGAAGACTGG + Intergenic
1199332211 X:146575621-146575643 AAATAATAACAGAAAAAGAAAGG + Intergenic
1200477906 Y:3664071-3664093 AGATAACAACACAATAAGAATGG - Intergenic
1200528334 Y:4299929-4299951 AAGTAATAAAAAATGAAGAAAGG + Intergenic
1200772761 Y:7142345-7142367 GAATAACAAAAGATAAATAAAGG - Intergenic
1201342854 Y:12952924-12952946 AAATAAAAAAAGAGGAAGAAAGG - Intergenic
1201424982 Y:13839906-13839928 AAATGATAACAGATGAACACTGG - Intergenic
1201487753 Y:14510210-14510232 AAATACCAGCAGAAGCAGAATGG + Intergenic
1201497836 Y:14608462-14608484 AAAAAACAAGCAATGAAGAAAGG - Intronic
1201624471 Y:15999039-15999061 CTATAACAACAAATGAATAAAGG - Intergenic
1201626095 Y:16016333-16016355 AAAAAAAAAAAGAAGAAGAAGGG + Intergenic
1201911067 Y:19134005-19134027 ATAGAATAACAGCTGAAGAAAGG + Intergenic
1201968080 Y:19760273-19760295 AAAAAAAAAAAGATAAAGAAGGG - Intergenic
1201980719 Y:19907117-19907139 AAAAAAAAAAAAATGAAGAAAGG + Intergenic