ID: 1072780990

View in Genome Browser
Species Human (GRCh38)
Location 10:98251692-98251714
Sequence CCTTCCTTACAGGACTGCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072780990_1072780996 -4 Left 1072780990 10:98251692-98251714 CCGCTGCAGTCCTGTAAGGAAGG 0: 1
1: 0
2: 3
3: 29
4: 220
Right 1072780996 10:98251711-98251733 AAGGGGACAGACAGGTTTTGAGG 0: 1
1: 0
2: 2
3: 19
4: 291
1072780990_1072780997 0 Left 1072780990 10:98251692-98251714 CCGCTGCAGTCCTGTAAGGAAGG 0: 1
1: 0
2: 3
3: 29
4: 220
Right 1072780997 10:98251715-98251737 GGACAGACAGGTTTTGAGGCAGG 0: 1
1: 0
2: 3
3: 17
4: 252
1072780990_1072780998 18 Left 1072780990 10:98251692-98251714 CCGCTGCAGTCCTGTAAGGAAGG 0: 1
1: 0
2: 3
3: 29
4: 220
Right 1072780998 10:98251733-98251755 GCAGGACGAAGCACTCTGCTAGG 0: 1
1: 0
2: 1
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072780990 Original CRISPR CCTTCCTTACAGGACTGCAG CGG (reversed) Exonic