ID: 1072780994

View in Genome Browser
Species Human (GRCh38)
Location 10:98251702-98251724
Sequence CTGTCTGTCCCCTTCCTTAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072780994_1072780997 -10 Left 1072780994 10:98251702-98251724 CCTGTAAGGAAGGGGACAGACAG 0: 1
1: 0
2: 0
3: 24
4: 217
Right 1072780997 10:98251715-98251737 GGACAGACAGGTTTTGAGGCAGG 0: 1
1: 0
2: 3
3: 17
4: 252
1072780994_1072780998 8 Left 1072780994 10:98251702-98251724 CCTGTAAGGAAGGGGACAGACAG 0: 1
1: 0
2: 0
3: 24
4: 217
Right 1072780998 10:98251733-98251755 GCAGGACGAAGCACTCTGCTAGG 0: 1
1: 0
2: 1
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072780994 Original CRISPR CTGTCTGTCCCCTTCCTTAC AGG (reversed) Exonic