ID: 1072780998

View in Genome Browser
Species Human (GRCh38)
Location 10:98251733-98251755
Sequence GCAGGACGAAGCACTCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072780990_1072780998 18 Left 1072780990 10:98251692-98251714 CCGCTGCAGTCCTGTAAGGAAGG 0: 1
1: 0
2: 3
3: 29
4: 220
Right 1072780998 10:98251733-98251755 GCAGGACGAAGCACTCTGCTAGG 0: 1
1: 0
2: 1
3: 12
4: 113
1072780994_1072780998 8 Left 1072780994 10:98251702-98251724 CCTGTAAGGAAGGGGACAGACAG 0: 1
1: 0
2: 0
3: 24
4: 217
Right 1072780998 10:98251733-98251755 GCAGGACGAAGCACTCTGCTAGG 0: 1
1: 0
2: 1
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072780998 Original CRISPR GCAGGACGAAGCACTCTGCT AGG Intronic