ID: 1072782107

View in Genome Browser
Species Human (GRCh38)
Location 10:98258137-98258159
Sequence GAGGGTGCGCCTGCGCTCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 105}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072782107_1072782112 -10 Left 1072782107 10:98258137-98258159 CCCCGGAGCGCAGGCGCACCCTC 0: 1
1: 0
2: 1
3: 9
4: 105
Right 1072782112 10:98258150-98258172 GCGCACCCTCGGCTCCTGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 159
1072782107_1072782118 11 Left 1072782107 10:98258137-98258159 CCCCGGAGCGCAGGCGCACCCTC 0: 1
1: 0
2: 1
3: 9
4: 105
Right 1072782118 10:98258171-98258193 GGAGAAACCTGCTTCAGGGACGG 0: 1
1: 0
2: 3
3: 43
4: 459
1072782107_1072782122 23 Left 1072782107 10:98258137-98258159 CCCCGGAGCGCAGGCGCACCCTC 0: 1
1: 0
2: 1
3: 9
4: 105
Right 1072782122 10:98258183-98258205 TTCAGGGACGGCTGAGGAGGAGG 0: 1
1: 0
2: 1
3: 36
4: 365
1072782107_1072782119 17 Left 1072782107 10:98258137-98258159 CCCCGGAGCGCAGGCGCACCCTC 0: 1
1: 0
2: 1
3: 9
4: 105
Right 1072782119 10:98258177-98258199 ACCTGCTTCAGGGACGGCTGAGG 0: 1
1: 0
2: 2
3: 20
4: 223
1072782107_1072782117 7 Left 1072782107 10:98258137-98258159 CCCCGGAGCGCAGGCGCACCCTC 0: 1
1: 0
2: 1
3: 9
4: 105
Right 1072782117 10:98258167-98258189 GCTGGGAGAAACCTGCTTCAGGG 0: 1
1: 0
2: 1
3: 19
4: 222
1072782107_1072782116 6 Left 1072782107 10:98258137-98258159 CCCCGGAGCGCAGGCGCACCCTC 0: 1
1: 0
2: 1
3: 9
4: 105
Right 1072782116 10:98258166-98258188 TGCTGGGAGAAACCTGCTTCAGG 0: 1
1: 0
2: 2
3: 19
4: 225
1072782107_1072782121 20 Left 1072782107 10:98258137-98258159 CCCCGGAGCGCAGGCGCACCCTC 0: 1
1: 0
2: 1
3: 9
4: 105
Right 1072782121 10:98258180-98258202 TGCTTCAGGGACGGCTGAGGAGG 0: 1
1: 0
2: 0
3: 27
4: 562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072782107 Original CRISPR GAGGGTGCGCCTGCGCTCCG GGG (reversed) Exonic