ID: 1072785036

View in Genome Browser
Species Human (GRCh38)
Location 10:98273562-98273584
Sequence CTGGGGGTGCAGGGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072785036_1072785054 25 Left 1072785036 10:98273562-98273584 CCCTCTTCCCCCTGCACCCCCAG No data
Right 1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG No data
1072785036_1072785051 18 Left 1072785036 10:98273562-98273584 CCCTCTTCCCCCTGCACCCCCAG No data
Right 1072785051 10:98273603-98273625 GCTTTCCCTGTCTCAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072785036 Original CRISPR CTGGGGGTGCAGGGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr