ID: 1072785040 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:98273571-98273593 |
Sequence | CAGGTGGCACTGGGGGTGCA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1072785040_1072785051 | 9 | Left | 1072785040 | 10:98273571-98273593 | CCCTGCACCCCCAGTGCCACCTG | No data | ||
Right | 1072785051 | 10:98273603-98273625 | GCTTTCCCTGTCTCAGCAGCTGG | No data | ||||
1072785040_1072785055 | 28 | Left | 1072785040 | 10:98273571-98273593 | CCCTGCACCCCCAGTGCCACCTG | No data | ||
Right | 1072785055 | 10:98273622-98273644 | CTGGACACAGGCGCAGCGCCTGG | No data | ||||
1072785040_1072785054 | 16 | Left | 1072785040 | 10:98273571-98273593 | CCCTGCACCCCCAGTGCCACCTG | No data | ||
Right | 1072785054 | 10:98273610-98273632 | CTGTCTCAGCAGCTGGACACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1072785040 | Original CRISPR | CAGGTGGCACTGGGGGTGCA GGG (reversed) | Intergenic | ||
No off target data available for this crispr |