ID: 1072785041

View in Genome Browser
Species Human (GRCh38)
Location 10:98273572-98273594
Sequence GCAGGTGGCACTGGGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072785041_1072785054 15 Left 1072785041 10:98273572-98273594 CCTGCACCCCCAGTGCCACCTGC No data
Right 1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG No data
1072785041_1072785051 8 Left 1072785041 10:98273572-98273594 CCTGCACCCCCAGTGCCACCTGC No data
Right 1072785051 10:98273603-98273625 GCTTTCCCTGTCTCAGCAGCTGG No data
1072785041_1072785055 27 Left 1072785041 10:98273572-98273594 CCTGCACCCCCAGTGCCACCTGC No data
Right 1072785055 10:98273622-98273644 CTGGACACAGGCGCAGCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072785041 Original CRISPR GCAGGTGGCACTGGGGGTGC AGG (reversed) Intergenic
No off target data available for this crispr