ID: 1072785045

View in Genome Browser
Species Human (GRCh38)
Location 10:98273581-98273603
Sequence CGGGGTTCTGCAGGTGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072785045_1072785055 18 Left 1072785045 10:98273581-98273603 CCAGTGCCACCTGCAGAACCCCG No data
Right 1072785055 10:98273622-98273644 CTGGACACAGGCGCAGCGCCTGG No data
1072785045_1072785051 -1 Left 1072785045 10:98273581-98273603 CCAGTGCCACCTGCAGAACCCCG No data
Right 1072785051 10:98273603-98273625 GCTTTCCCTGTCTCAGCAGCTGG No data
1072785045_1072785054 6 Left 1072785045 10:98273581-98273603 CCAGTGCCACCTGCAGAACCCCG No data
Right 1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072785045 Original CRISPR CGGGGTTCTGCAGGTGGCAC TGG (reversed) Intergenic
No off target data available for this crispr