ID: 1072785054

View in Genome Browser
Species Human (GRCh38)
Location 10:98273610-98273632
Sequence CTGTCTCAGCAGCTGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072785043_1072785054 8 Left 1072785043 10:98273579-98273601 CCCCAGTGCCACCTGCAGAACCC No data
Right 1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG No data
1072785036_1072785054 25 Left 1072785036 10:98273562-98273584 CCCTCTTCCCCCTGCACCCCCAG No data
Right 1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG No data
1072785040_1072785054 16 Left 1072785040 10:98273571-98273593 CCCTGCACCCCCAGTGCCACCTG No data
Right 1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG No data
1072785045_1072785054 6 Left 1072785045 10:98273581-98273603 CCAGTGCCACCTGCAGAACCCCG No data
Right 1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG No data
1072785041_1072785054 15 Left 1072785041 10:98273572-98273594 CCTGCACCCCCAGTGCCACCTGC No data
Right 1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG No data
1072785042_1072785054 9 Left 1072785042 10:98273578-98273600 CCCCCAGTGCCACCTGCAGAACC No data
Right 1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG No data
1072785046_1072785054 0 Left 1072785046 10:98273587-98273609 CCACCTGCAGAACCCCGCTTTCC No data
Right 1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG No data
1072785038_1072785054 18 Left 1072785038 10:98273569-98273591 CCCCCTGCACCCCCAGTGCCACC No data
Right 1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG No data
1072785044_1072785054 7 Left 1072785044 10:98273580-98273602 CCCAGTGCCACCTGCAGAACCCC No data
Right 1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG No data
1072785037_1072785054 24 Left 1072785037 10:98273563-98273585 CCTCTTCCCCCTGCACCCCCAGT No data
Right 1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG No data
1072785047_1072785054 -3 Left 1072785047 10:98273590-98273612 CCTGCAGAACCCCGCTTTCCCTG No data
Right 1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG No data
1072785039_1072785054 17 Left 1072785039 10:98273570-98273592 CCCCTGCACCCCCAGTGCCACCT No data
Right 1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072785054 Original CRISPR CTGTCTCAGCAGCTGGACAC AGG Intergenic
No off target data available for this crispr