ID: 1072785974

View in Genome Browser
Species Human (GRCh38)
Location 10:98282546-98282568
Sequence CTGTGTGTGTACATGTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072785973_1072785974 21 Left 1072785973 10:98282502-98282524 CCTGATCTTTGCTGGTGTGTGTG No data
Right 1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072785974 Original CRISPR CTGTGTGTGTACATGTGTGT TGG Intergenic
No off target data available for this crispr