ID: 1072789651

View in Genome Browser
Species Human (GRCh38)
Location 10:98308956-98308978
Sequence GGGGCTTGAGCTCATTTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072789641_1072789651 8 Left 1072789641 10:98308925-98308947 CCGGCGGCGCAGGGGGAGGCAGG No data
Right 1072789651 10:98308956-98308978 GGGGCTTGAGCTCATTTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072789651 Original CRISPR GGGGCTTGAGCTCATTTCAG GGG Intergenic
No off target data available for this crispr