ID: 1072792276

View in Genome Browser
Species Human (GRCh38)
Location 10:98327011-98327033
Sequence CCCCAGAGACCACTGTCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072792276_1072792283 23 Left 1072792276 10:98327011-98327033 CCGCTGGACAGTGGTCTCTGGGG No data
Right 1072792283 10:98327057-98327079 GCCCTCTCTGCAAGGGACCTGGG No data
1072792276_1072792281 16 Left 1072792276 10:98327011-98327033 CCGCTGGACAGTGGTCTCTGGGG No data
Right 1072792281 10:98327050-98327072 TTCAGCTGCCCTCTCTGCAAGGG No data
1072792276_1072792278 -10 Left 1072792276 10:98327011-98327033 CCGCTGGACAGTGGTCTCTGGGG No data
Right 1072792278 10:98327024-98327046 GTCTCTGGGGACATTATGAGAGG No data
1072792276_1072792280 15 Left 1072792276 10:98327011-98327033 CCGCTGGACAGTGGTCTCTGGGG No data
Right 1072792280 10:98327049-98327071 CTTCAGCTGCCCTCTCTGCAAGG No data
1072792276_1072792282 22 Left 1072792276 10:98327011-98327033 CCGCTGGACAGTGGTCTCTGGGG No data
Right 1072792282 10:98327056-98327078 TGCCCTCTCTGCAAGGGACCTGG No data
1072792276_1072792285 24 Left 1072792276 10:98327011-98327033 CCGCTGGACAGTGGTCTCTGGGG No data
Right 1072792285 10:98327058-98327080 CCCTCTCTGCAAGGGACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072792276 Original CRISPR CCCCAGAGACCACTGTCCAG CGG (reversed) Intergenic
No off target data available for this crispr