ID: 1072795907

View in Genome Browser
Species Human (GRCh38)
Location 10:98354484-98354506
Sequence GGCCACACCATTTAAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072795903_1072795907 5 Left 1072795903 10:98354456-98354478 CCAAGGATGCCTTTTAAAAAATA No data
Right 1072795907 10:98354484-98354506 GGCCACACCATTTAAAAGAAAGG No data
1072795900_1072795907 25 Left 1072795900 10:98354436-98354458 CCTCTCTCATCTTGTCAAGCCCA No data
Right 1072795907 10:98354484-98354506 GGCCACACCATTTAAAAGAAAGG No data
1072795906_1072795907 -4 Left 1072795906 10:98354465-98354487 CCTTTTAAAAAATAGGAAAGGCC No data
Right 1072795907 10:98354484-98354506 GGCCACACCATTTAAAAGAAAGG No data
1072795902_1072795907 6 Left 1072795902 10:98354455-98354477 CCCAAGGATGCCTTTTAAAAAAT No data
Right 1072795907 10:98354484-98354506 GGCCACACCATTTAAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072795907 Original CRISPR GGCCACACCATTTAAAAGAA AGG Intergenic
No off target data available for this crispr