ID: 1072798080

View in Genome Browser
Species Human (GRCh38)
Location 10:98371961-98371983
Sequence CTCTCCTAACACCTCGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072798080_1072798083 3 Left 1072798080 10:98371961-98371983 CCACACTCGAGGTGTTAGGAGAG No data
Right 1072798083 10:98371987-98372009 CACTTCCTCTGAAACCTCCTGGG No data
1072798080_1072798085 5 Left 1072798080 10:98371961-98371983 CCACACTCGAGGTGTTAGGAGAG No data
Right 1072798085 10:98371989-98372011 CTTCCTCTGAAACCTCCTGGGGG No data
1072798080_1072798088 9 Left 1072798080 10:98371961-98371983 CCACACTCGAGGTGTTAGGAGAG No data
Right 1072798088 10:98371993-98372015 CTCTGAAACCTCCTGGGGGGTGG No data
1072798080_1072798092 15 Left 1072798080 10:98371961-98371983 CCACACTCGAGGTGTTAGGAGAG No data
Right 1072798092 10:98371999-98372021 AACCTCCTGGGGGGTGGCGGGGG No data
1072798080_1072798086 6 Left 1072798080 10:98371961-98371983 CCACACTCGAGGTGTTAGGAGAG No data
Right 1072798086 10:98371990-98372012 TTCCTCTGAAACCTCCTGGGGGG No data
1072798080_1072798093 16 Left 1072798080 10:98371961-98371983 CCACACTCGAGGTGTTAGGAGAG No data
Right 1072798093 10:98372000-98372022 ACCTCCTGGGGGGTGGCGGGGGG No data
1072798080_1072798091 14 Left 1072798080 10:98371961-98371983 CCACACTCGAGGTGTTAGGAGAG No data
Right 1072798091 10:98371998-98372020 AAACCTCCTGGGGGGTGGCGGGG No data
1072798080_1072798089 12 Left 1072798080 10:98371961-98371983 CCACACTCGAGGTGTTAGGAGAG No data
Right 1072798089 10:98371996-98372018 TGAAACCTCCTGGGGGGTGGCGG No data
1072798080_1072798090 13 Left 1072798080 10:98371961-98371983 CCACACTCGAGGTGTTAGGAGAG No data
Right 1072798090 10:98371997-98372019 GAAACCTCCTGGGGGGTGGCGGG No data
1072798080_1072798084 4 Left 1072798080 10:98371961-98371983 CCACACTCGAGGTGTTAGGAGAG No data
Right 1072798084 10:98371988-98372010 ACTTCCTCTGAAACCTCCTGGGG No data
1072798080_1072798082 2 Left 1072798080 10:98371961-98371983 CCACACTCGAGGTGTTAGGAGAG No data
Right 1072798082 10:98371986-98372008 ACACTTCCTCTGAAACCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072798080 Original CRISPR CTCTCCTAACACCTCGAGTG TGG (reversed) Intergenic
No off target data available for this crispr