ID: 1072798085

View in Genome Browser
Species Human (GRCh38)
Location 10:98371989-98372011
Sequence CTTCCTCTGAAACCTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072798074_1072798085 29 Left 1072798074 10:98371937-98371959 CCCACAGTTCTGGAGGCCAGAGG No data
Right 1072798085 10:98371989-98372011 CTTCCTCTGAAACCTCCTGGGGG No data
1072798076_1072798085 28 Left 1072798076 10:98371938-98371960 CCACAGTTCTGGAGGCCAGAGGA No data
Right 1072798085 10:98371989-98372011 CTTCCTCTGAAACCTCCTGGGGG No data
1072798078_1072798085 13 Left 1072798078 10:98371953-98371975 CCAGAGGACCACACTCGAGGTGT No data
Right 1072798085 10:98371989-98372011 CTTCCTCTGAAACCTCCTGGGGG No data
1072798080_1072798085 5 Left 1072798080 10:98371961-98371983 CCACACTCGAGGTGTTAGGAGAG No data
Right 1072798085 10:98371989-98372011 CTTCCTCTGAAACCTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072798085 Original CRISPR CTTCCTCTGAAACCTCCTGG GGG Intergenic
No off target data available for this crispr