ID: 1072798089 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:98371996-98372018 |
| Sequence | TGAAACCTCCTGGGGGGTGG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1072798078_1072798089 | 20 | Left | 1072798078 | 10:98371953-98371975 | CCAGAGGACCACACTCGAGGTGT | No data | ||
| Right | 1072798089 | 10:98371996-98372018 | TGAAACCTCCTGGGGGGTGGCGG | No data | ||||
| 1072798080_1072798089 | 12 | Left | 1072798080 | 10:98371961-98371983 | CCACACTCGAGGTGTTAGGAGAG | No data | ||
| Right | 1072798089 | 10:98371996-98372018 | TGAAACCTCCTGGGGGGTGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1072798089 | Original CRISPR | TGAAACCTCCTGGGGGGTGG CGG | Intergenic | ||
| No off target data available for this crispr | |||||