ID: 1072798089

View in Genome Browser
Species Human (GRCh38)
Location 10:98371996-98372018
Sequence TGAAACCTCCTGGGGGGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072798078_1072798089 20 Left 1072798078 10:98371953-98371975 CCAGAGGACCACACTCGAGGTGT No data
Right 1072798089 10:98371996-98372018 TGAAACCTCCTGGGGGGTGGCGG No data
1072798080_1072798089 12 Left 1072798080 10:98371961-98371983 CCACACTCGAGGTGTTAGGAGAG No data
Right 1072798089 10:98371996-98372018 TGAAACCTCCTGGGGGGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072798089 Original CRISPR TGAAACCTCCTGGGGGGTGG CGG Intergenic
No off target data available for this crispr