ID: 1072798092

View in Genome Browser
Species Human (GRCh38)
Location 10:98371999-98372021
Sequence AACCTCCTGGGGGGTGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072798081_1072798092 -8 Left 1072798081 10:98371984-98372006 CCACACTTCCTCTGAAACCTCCT No data
Right 1072798092 10:98371999-98372021 AACCTCCTGGGGGGTGGCGGGGG No data
1072798080_1072798092 15 Left 1072798080 10:98371961-98371983 CCACACTCGAGGTGTTAGGAGAG No data
Right 1072798092 10:98371999-98372021 AACCTCCTGGGGGGTGGCGGGGG No data
1072798078_1072798092 23 Left 1072798078 10:98371953-98371975 CCAGAGGACCACACTCGAGGTGT No data
Right 1072798092 10:98371999-98372021 AACCTCCTGGGGGGTGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072798092 Original CRISPR AACCTCCTGGGGGGTGGCGG GGG Intergenic
No off target data available for this crispr