ID: 1072799756

View in Genome Browser
Species Human (GRCh38)
Location 10:98384855-98384877
Sequence AGGAGGAAGTTAAGCAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 422}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072799756_1072799769 30 Left 1072799756 10:98384855-98384877 CCTTCATTGCTTAACTTCCTCCT 0: 1
1: 0
2: 3
3: 33
4: 422
Right 1072799769 10:98384908-98384930 CCCAGTCCCCACAGGGTAGTGGG 0: 1
1: 1
2: 0
3: 11
4: 158
1072799756_1072799763 22 Left 1072799756 10:98384855-98384877 CCTTCATTGCTTAACTTCCTCCT 0: 1
1: 0
2: 3
3: 33
4: 422
Right 1072799763 10:98384900-98384922 TGAGCCCTCCCAGTCCCCACAGG 0: 1
1: 0
2: 3
3: 35
4: 259
1072799756_1072799764 23 Left 1072799756 10:98384855-98384877 CCTTCATTGCTTAACTTCCTCCT 0: 1
1: 0
2: 3
3: 33
4: 422
Right 1072799764 10:98384901-98384923 GAGCCCTCCCAGTCCCCACAGGG 0: 1
1: 0
2: 2
3: 30
4: 247
1072799756_1072799757 -8 Left 1072799756 10:98384855-98384877 CCTTCATTGCTTAACTTCCTCCT 0: 1
1: 0
2: 3
3: 33
4: 422
Right 1072799757 10:98384870-98384892 TTCCTCCTTCTCCAAGTCTCTGG 0: 1
1: 0
2: 5
3: 87
4: 604
1072799756_1072799767 29 Left 1072799756 10:98384855-98384877 CCTTCATTGCTTAACTTCCTCCT 0: 1
1: 0
2: 3
3: 33
4: 422
Right 1072799767 10:98384907-98384929 TCCCAGTCCCCACAGGGTAGTGG 0: 1
1: 0
2: 2
3: 17
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072799756 Original CRISPR AGGAGGAAGTTAAGCAATGA AGG (reversed) Intronic
901939564 1:12651724-12651746 AGGAGGCAGGCAAGCAAGGATGG - Intronic
903278114 1:22234166-22234188 TGGAGGAATGTAAGCTATGAGGG - Intergenic
904632236 1:31851170-31851192 AGGAGGAAATTAAGACATGAGGG + Intergenic
905317188 1:37090343-37090365 AGGAGGAAAGTAAGAAAAGAGGG - Intergenic
906953072 1:50350026-50350048 ATGAGGAAGTTCATCTATGAGGG - Intergenic
907888633 1:58617344-58617366 AGAAGGAAGGTAAGAAATAAAGG - Intergenic
908499459 1:64728811-64728833 AGGAGGTGGTTAAGTTATGAGGG + Intergenic
908671174 1:66549186-66549208 AGGAGGAAGGGAAGGAAGGAAGG - Intronic
909377825 1:74960490-74960512 TGGAGGAAGTCAAGCAATTTTGG - Intergenic
909474376 1:76065532-76065554 AGGAGGGAGTTTAGCATTGAGGG + Intergenic
909809762 1:79917937-79917959 AGGAAAAAGATAAGCAATAAAGG + Intergenic
910115040 1:83722480-83722502 AGTAGGCATTTAAGCAATGTTGG - Intergenic
915167606 1:153957337-153957359 AGAAGGAATTTAAGGATTGATGG - Intronic
915268923 1:154738533-154738555 AGGAGGAAGACAAGGAATAAAGG + Intronic
916627245 1:166571627-166571649 AGGAGGAATTTTAGCAATAGGGG + Intergenic
916923993 1:169498427-169498449 AGAAGGAAGGGAAGCCATGAGGG + Intergenic
917282132 1:173387277-173387299 AGGAGGTGATTAGGCAATGAGGG + Intergenic
918323644 1:183389024-183389046 AGGAGGGAGTTAGGGAATGGAGG + Intronic
919259708 1:195176328-195176350 ATGAAAAAGTTAAGCACTGAAGG + Intergenic
921187489 1:212683059-212683081 AGGAGGAAGAGAAGGAAAGAGGG - Intergenic
922242378 1:223764217-223764239 AGGATGAGGTTTTGCAATGAGGG - Intronic
923247575 1:232147459-232147481 AGGAGGAAGTGAAGGAAGAAGGG + Intergenic
924282957 1:242456432-242456454 AGTAGAAAGTTCTGCAATGATGG - Intronic
1063703268 10:8406521-8406543 AGGAGAAAGGCAAGCCATGAAGG + Intergenic
1065228815 10:23575462-23575484 AGGAGGTGATTAAGTAATGAGGG + Intergenic
1065297303 10:24289318-24289340 AGGAAGGAGTTAACCAGTGAAGG + Intronic
1065350935 10:24795140-24795162 AGGAGGTAATTAAGCCATAAGGG + Intergenic
1065551217 10:26870299-26870321 AGGAGAAAGAAAAGCAATAAAGG + Intergenic
1065659050 10:27986455-27986477 AGGAGGTAGTTAATAGATGAAGG - Intronic
1065709038 10:28497734-28497756 AGGAGGAAGGGAAGGAAGGAAGG + Intergenic
1069547639 10:69340042-69340064 AGGAGGAATTCAAACAATGCTGG - Intronic
1072799756 10:98384855-98384877 AGGAGGAAGTTAAGCAATGAAGG - Intronic
1073596102 10:104801719-104801741 AGAAGGAACTGAAGCATTGAGGG + Intronic
1073625489 10:105091552-105091574 AGGAGGAAGGGAAGGAAGGAGGG - Intronic
1073630943 10:105148550-105148572 AGGATTGAGTTGAGCAATGAAGG + Intronic
1073831908 10:107394240-107394262 TGTAGGAACTTAACCAATGAAGG - Intergenic
1074543196 10:114383333-114383355 AGGAGGAAGGGAAGGAAAGATGG + Intronic
1074607950 10:114993113-114993135 AGGAGGAAGAAAAGAAAGGAAGG + Intergenic
1075136033 10:119787218-119787240 ATAAGGAAGTTAAGGGATGATGG + Intronic
1075750652 10:124768192-124768214 AGGAAGAAGGTAAGAAATGAGGG + Intronic
1077761862 11:5109859-5109881 CTGAGGAAGTTAGGCAGTGAAGG + Intergenic
1077866225 11:6223794-6223816 AGGAAGAACTCGAGCAATGAAGG + Exonic
1079766184 11:24396073-24396095 AGGAGGTAATTAAGTCATGAGGG - Intergenic
1079837413 11:25351230-25351252 AGGAGGAAGTGCAGCGATTATGG - Intergenic
1080233749 11:30045981-30046003 AGGAGTTAGGTAAGCAATGCAGG + Intergenic
1082765207 11:57162265-57162287 AGGAGGAGCTAAAGGAATGAGGG + Intergenic
1084625217 11:70300886-70300908 AGGATCAAGATAAGCCATGAGGG + Intronic
1084850325 11:71934188-71934210 AGGACTAAGTTGAGAAATGAGGG - Intronic
1084915858 11:72428544-72428566 AGGAGCAAGCTAAGCAAAGGCGG - Intronic
1085776988 11:79375878-79375900 AGTAGGAAGTTTAGCATTGTGGG + Intronic
1086528315 11:87755187-87755209 AGGAGGGAGGGAAGGAATGAAGG - Intergenic
1086747273 11:90445113-90445135 AGGAGAAAATTAACCACTGAAGG - Intergenic
1086840478 11:91677436-91677458 AGGAGGAAGTAATGGAATAATGG + Intergenic
1086950488 11:92885685-92885707 AGGGGGGAGTTAATAAATGAAGG + Intronic
1087331174 11:96782580-96782602 AGGGAGAAGTTGAGCTATGATGG + Intergenic
1087462325 11:98461444-98461466 AGGAGGAGATTAAGTCATGAGGG + Intergenic
1089143813 11:116309754-116309776 AGGAGGAAATTAAGTCATGAGGG + Intergenic
1090487057 11:127122702-127122724 AGGTGACAGCTAAGCAATGAGGG - Intergenic
1090586548 11:128219347-128219369 GAGAGGAAGTAAAGGAATGATGG + Intergenic
1090640736 11:128726887-128726909 AGGAGGAAGTTAAGTTCTGAAGG + Intronic
1091532617 12:1374297-1374319 AGAAAGAGGTGAAGCAATGAGGG + Intronic
1091647080 12:2282067-2282089 GGAAGGAAGATAAGGAATGAGGG - Intronic
1092227821 12:6759936-6759958 AGGAGGCACTCAAGGAATGAGGG + Intronic
1092578902 12:9818956-9818978 AGGATGAAGTAAAGCAAGGCAGG + Intergenic
1093184931 12:16008791-16008813 AATAGGAAGAAAAGCAATGAAGG + Intronic
1094229126 12:28082887-28082909 AGGAGGGGGTTAAGGAAGGATGG - Intergenic
1094494400 12:30980430-30980452 AGGAGAACGTTCTGCAATGAAGG - Intronic
1096018460 12:48300750-48300772 GGGAGGTAATTAAGTAATGAAGG + Intergenic
1096780614 12:53989859-53989881 AGGAGGAAATGCAGCAAGGAAGG - Exonic
1098331567 12:69359149-69359171 AGGAGGAAATTATGAAATGCAGG - Intergenic
1100172582 12:91992516-91992538 AGAAGGAAGGTGTGCAATGAGGG + Intronic
1100243578 12:92733986-92734008 TGGAGGGAGGGAAGCAATGAGGG + Intronic
1100243591 12:92734291-92734313 AGGAGGAAGGGAAGAAAGGAAGG - Intronic
1101049137 12:100842822-100842844 AGGAGGTGGTTAAGCCATGGGGG - Intronic
1102425876 12:112844041-112844063 AGGAGGCATTCAAGCAAGGATGG + Intronic
1102452713 12:113053738-113053760 TGGAGGAAGGGAAGCAAGGAAGG + Intergenic
1102721997 12:115024353-115024375 ACTAGGAGGTTAATCAATGAAGG + Intergenic
1102809588 12:115812872-115812894 AGGAGGAAGTTATCCAGGGAAGG - Intergenic
1102913680 12:116737583-116737605 AGGAGGAAGATAAGGAAGGAGGG + Intronic
1102913710 12:116737695-116737717 AGGAGGAAGGTAACGAAGGAAGG + Intronic
1103113410 12:118303220-118303242 AGGAGGAGGATAAGGAATGGGGG - Intronic
1103367019 12:120390785-120390807 AGGAGGAAGGGAAGGAAGGAAGG + Intergenic
1104238598 12:126964046-126964068 AGGAGGGAGGGAAGCAAGGAAGG + Intergenic
1106029780 13:25989746-25989768 AGGAGGAAGGAAAGAAATGGAGG - Intronic
1106086115 13:26543263-26543285 AGGAGAGAGTTAAGCATAGATGG + Intergenic
1107115092 13:36738332-36738354 AGAAGGAAGCGAAGCAATGAGGG + Intergenic
1107917626 13:45168859-45168881 AGGAGGGAGAGAAGCAAGGAGGG - Intronic
1108022531 13:46143276-46143298 ATGAAGAAGGTAAACAATGATGG - Exonic
1108510911 13:51155064-51155086 AGGAGATAGTTAAGAATTGAGGG - Intergenic
1108942331 13:55972157-55972179 AGGAGGACAGCAAGCAATGAGGG - Intergenic
1110187858 13:72695576-72695598 AGGAGGCAGTTATGCAAAGGTGG + Intergenic
1110608051 13:77456582-77456604 AGGAGGAAAGGAAGCAACGAAGG - Intergenic
1110706736 13:78606936-78606958 AGGAGAAAATTAATTAATGAGGG - Intergenic
1110943155 13:81378198-81378220 TGGAGAAAGTTAAGAAATAAGGG + Intergenic
1111113721 13:83749519-83749541 AGGAGTAAGTTGAGCATAGAGGG - Intergenic
1111134090 13:84017305-84017327 AGAAGCAATTCAAGCAATGATGG - Intergenic
1111489109 13:88946197-88946219 ATGAGCAGGTTAATCAATGAAGG - Intergenic
1111497877 13:89076900-89076922 AGGAGGAAGGAAAGAAAGGAAGG - Intergenic
1111874628 13:93878253-93878275 AGGAGGTAATTAGGCCATGAGGG + Intronic
1112868140 13:103934015-103934037 AGGAGGAAGGGAAGCTAGGAAGG - Intergenic
1113089735 13:106604382-106604404 AGGAGGAGGTAAAGAAAGGAGGG + Intergenic
1113221098 13:108103468-108103490 AGGAAGAAGGATAGCAATGAAGG + Intergenic
1113250040 13:108442601-108442623 TGGAGGAAATTCAGCCATGAGGG - Intergenic
1114593171 14:23887736-23887758 AGGAGGAAATGAAGGAAGGAAGG + Intergenic
1115367366 14:32573191-32573213 AGGAGGAGTTTGAACAATGAAGG + Intronic
1116315486 14:43385745-43385767 TGGAATAAGTCAAGCAATGAAGG + Intergenic
1117267291 14:54103147-54103169 AAGATGAAGTTAAGAAATGAAGG + Intergenic
1118058821 14:62113371-62113393 TGGAGGAAGAAAAGCCATGAGGG + Intergenic
1118090608 14:62472540-62472562 AGGAGGAACTAGAGCAAAGATGG + Intergenic
1118455750 14:65944553-65944575 AAGAGGTGGTTAAGCCATGAAGG - Intergenic
1120623977 14:86802024-86802046 AGGAGGAAGTTAATTAATGAAGG + Intergenic
1120831446 14:89000907-89000929 AGGAGAAAGAAAAGAAATGAAGG - Intergenic
1120924554 14:89784678-89784700 AGGAGGTAATTAAGTCATGAAGG + Intergenic
1121800208 14:96768690-96768712 AGGAGGAAGGGAAGGAAGGAAGG - Intergenic
1122207502 14:100155324-100155346 AGGAAGAAGTTTAGGAAGGAGGG - Intronic
1122412271 14:101531721-101531743 AGCAGGAAGTAAAGCCAAGAGGG + Intergenic
1123190082 14:106560959-106560981 AGGAGGAAGGTGAGCAATGAGGG - Intergenic
1123201410 14:106668820-106668842 AAGACGAAGGTGAGCAATGAGGG - Intergenic
1123495774 15:20824184-20824206 ATGAGGAATTTCAGCAAAGATGG + Intergenic
1123552260 15:21393276-21393298 ATGAGGAATTTCAGCAAAGATGG + Intergenic
1123588504 15:21830673-21830695 ATGAGGAATTTCAGCAAAGATGG + Intergenic
1124133506 15:27011356-27011378 AGGAGGAAGAGAAGCCAGGAAGG - Intronic
1124717146 15:32073965-32073987 AGGAAGAAGGAAAACAATGAAGG - Intronic
1125757431 15:42072958-42072980 AGGAGGAAATTAAGAACAGAAGG - Intronic
1126370181 15:47937894-47937916 AGGAGGAAGGAAAGAAGTGAGGG + Intergenic
1126448872 15:48782812-48782834 ATGATTAAGTGAAGCAATGATGG + Intronic
1127227421 15:56947370-56947392 AGGAGGAAGCTACGCAGAGAAGG - Intronic
1127286799 15:57539880-57539902 AGGAGGAATCTAAGCACAGATGG + Intronic
1127930767 15:63595914-63595936 AGAAGGCAGTCAAGCAAAGAAGG - Intergenic
1128455981 15:67831673-67831695 AGGAGGAAGACAAGCATTGGTGG + Intronic
1128676904 15:69616324-69616346 AGTAGGAGGTTCTGCAATGATGG - Intergenic
1128798943 15:70484840-70484862 TGGAGGAAATTAAGGCATGAAGG + Intergenic
1128812019 15:70579827-70579849 AGGAGGAAGAGAAGGAAAGAAGG + Intergenic
1130422516 15:83762647-83762669 AGGAGGTAATTAAGTTATGAGGG - Intronic
1130723321 15:86411577-86411599 AGAAGGAAGGTGGGCAATGAAGG - Intronic
1131152238 15:90054356-90054378 AGGAGGAAGGGAAGCCATGAGGG + Intronic
1202960608 15_KI270727v1_random:120509-120531 ATGAGGAATTTCAGCAAAGATGG + Intergenic
1133473073 16:6094371-6094393 AGGAGGCATTTAGGCAAAGAGGG + Intronic
1133590962 16:7242962-7242984 AGGAGGAAGAGAACAAATGAAGG - Intronic
1134836777 16:17367984-17368006 AGGAGGAAGTGAAGAAAAGCAGG - Intronic
1134839843 16:17393017-17393039 AGGAGGAAGGAAAGAAAAGAGGG - Intronic
1135185798 16:20314765-20314787 AGGAGGATGTGAAGCAGTTATGG - Intronic
1135470679 16:22727235-22727257 AGGAGGAGGTTAAGCAATTGTGG + Intergenic
1135473794 16:22755647-22755669 AGGAGGAAGCTAAGTCATGAAGG - Intergenic
1135892678 16:26371635-26371657 GGAAGGAAGTTAAGAAAGGAAGG + Intergenic
1135934722 16:26770173-26770195 AGGAGGAAAATGAGGAATGAAGG + Intergenic
1135961882 16:27001803-27001825 AGGAGGTAATTAAGTCATGAGGG - Intergenic
1137913295 16:52401513-52401535 AGGAGGAAGTAAAGAAAGAAAGG + Intergenic
1138621232 16:58212932-58212954 AGGAGGAAGAAAAGAAAGGAAGG + Intergenic
1138980671 16:62264405-62264427 AGGAGGAAGTAAAGGAAGGAAGG - Intergenic
1139116289 16:63957931-63957953 AGGAGGAAATTAAGTCATGAGGG - Intergenic
1139574132 16:67830741-67830763 AACAGGAAGGTAAGCAAGGAGGG - Intronic
1140895006 16:79317172-79317194 AGGAGGGAGAAAAGCAAGGAAGG - Intergenic
1141840449 16:86570989-86571011 AGGAGGAAGTTAAGGAGGTAGGG + Intergenic
1142949572 17:3466824-3466846 AGGAGGTAATTAAGTCATGAGGG - Intronic
1143250173 17:5517686-5517708 AGGAGAAAGAAAATCAATGAAGG - Intronic
1143338199 17:6189250-6189272 AGGTTGAAGCTAAGCTATGAAGG - Intergenic
1143570578 17:7755509-7755531 AGGAGGAAGTGAAGTAGGGAGGG + Intronic
1146308458 17:31748772-31748794 AGGAGGAAGAAAAGGAATAAGGG + Intergenic
1146940047 17:36838129-36838151 AGGAGGAAGCTGAGAAAAGAAGG - Intergenic
1147359364 17:39921498-39921520 ATGAGGAAGTTAAGGGGTGAGGG + Intronic
1148318461 17:46725957-46725979 AGAATGAAATTAAGCAGTGAAGG - Intronic
1149024690 17:52013208-52013230 AGGAGGAAATAAATCAATGTAGG + Intronic
1150545639 17:66154889-66154911 AAGAGGTAGTTAGGCCATGAAGG + Intronic
1151078209 17:71298795-71298817 ATCAGGAACTTAATCAATGATGG - Intergenic
1151379285 17:73713740-73713762 AGGAGCAAGTTGTTCAATGAGGG + Intergenic
1153187183 18:2498765-2498787 AGGAGAAAGTGAAGCAAACAGGG + Intergenic
1153448923 18:5204832-5204854 AGAAGGAAGTTTAGCCAAGAGGG + Intergenic
1154453174 18:14496638-14496660 ATGAGGAATTTCAGCAAAGATGG + Intergenic
1154959928 18:21297943-21297965 AGGAGAAAGGAAAACAATGATGG + Intronic
1155927778 18:31675657-31675679 AGGAGGAAATGAAGAAATCAAGG + Intronic
1155937794 18:31772311-31772333 AAGTGGAAGCTAAGCTATGAGGG + Intergenic
1156276122 18:35584451-35584473 AAGAGGCAGTTAGGCAAAGAGGG + Intronic
1156529260 18:37799064-37799086 AAGAGGTAGTTAGGCCATGAGGG + Intergenic
1157712791 18:49861544-49861566 AGGAGGGAGAAAAGGAATGAAGG - Intronic
1157913473 18:51641083-51641105 AGAAGGAAGATGAGCAATAATGG - Intergenic
1159098966 18:63937334-63937356 AGGAGGAAGTTGAGCAGTTTGGG - Intergenic
1160297047 18:77648495-77648517 AGAAGGAAAATCAGCAATGAAGG - Intergenic
1162189395 19:8932835-8932857 AGGAGGAAGTTAAGAGAGGAAGG + Intronic
1162814860 19:13187577-13187599 GGGAGGGAGGTAAGCAAGGAAGG - Intergenic
1163703178 19:18797081-18797103 AGGAGGAAGGGAAGGAAGGAAGG - Intergenic
1163784145 19:19266008-19266030 AGGAGGAGTTTGAGCAGTGAGGG - Intronic
1164509656 19:28886860-28886882 GGAAGGAAGGTAGGCAATGAGGG + Intergenic
1164567951 19:29341816-29341838 AGCAGGAAGTGAAGGAAGGAAGG + Intergenic
1164588677 19:29494477-29494499 GGGAGGAAGGTAAGTAAGGAAGG + Intergenic
1164916808 19:32058480-32058502 AGGAGGAAGAAAAGGAAGGAAGG - Intergenic
1165100571 19:33436292-33436314 GGGAGGAAGAGAAGGAATGAGGG + Intronic
1165205389 19:34180663-34180685 AGAAGGAAGTAAAGTTATGAGGG - Intronic
1165289254 19:34869971-34869993 AGGAGGGAGGGAAGCAAGGAAGG + Intergenic
1165664304 19:37613870-37613892 AGGAGGAAATTAGGTCATGAGGG + Exonic
1166886213 19:45962496-45962518 TGGAGGGTGTTAAGCAATGATGG - Intronic
1167489122 19:49781724-49781746 AGGAGGAGGGTAGGCAGTGAGGG - Intronic
926244509 2:11113230-11113252 AGGAGGAAGGGAAGGAAGGAGGG - Intergenic
927422798 2:22950589-22950611 AGGAGGAAGATAAGGAATTATGG - Intergenic
928184987 2:29102126-29102148 AGAAGGGAGGAAAGCAATGAGGG + Intronic
929071444 2:38035485-38035507 CTGAAGAAGTCAAGCAATGAGGG + Intronic
930271292 2:49260612-49260634 ATGAGGAAGTCAAGAAATCAAGG + Intergenic
931830207 2:66043196-66043218 AGGAGGTGATTAAGTAATGAGGG - Intergenic
931900338 2:66781394-66781416 AGGAGCAAGTTAAGGAGGGAGGG + Intergenic
932472476 2:71969710-71969732 AGGAGGTAATTAGGCTATGAGGG + Intergenic
932628718 2:73320125-73320147 AGGAGAAAGGGAAGCAATGAAGG - Intergenic
933139370 2:78775139-78775161 AGGAGGGAAGTAAGCTATGATGG - Intergenic
933429147 2:82152627-82152649 ATGACCAAGTTAAGAAATGAAGG - Intergenic
933443245 2:82342049-82342071 AGGAGGAAGTAAAAATATGAAGG - Intergenic
933650131 2:84843771-84843793 AGGAGGTGATTAAGCCATGAAGG - Intronic
935167829 2:100585117-100585139 AGGAGGAATTTAAGTCATGGGGG + Intergenic
935370458 2:102340921-102340943 AGGAGGAAGTAAAGGGAGGAGGG - Intronic
936892776 2:117391895-117391917 AGGAGACAGTTAAACAAAGAGGG - Intergenic
937058357 2:118959898-118959920 ATGAGGGAGCTAAGCCATGAAGG + Intronic
937931598 2:127209154-127209176 AGGCTGAAGTGCAGCAATGATGG - Intronic
938160359 2:128979944-128979966 AGTAGGAAGTTAAGCCATCATGG + Intergenic
939636404 2:144587955-144587977 AGAAGGAAGGGAAGAAATGAAGG + Intergenic
941187167 2:162331489-162331511 AGGAGGAGGTTAGACCATGAGGG + Intronic
941465312 2:165818660-165818682 AGGAGGAAGTTAAGGACAAAAGG - Intergenic
943078503 2:183228173-183228195 AGGAGTATGATATGCAATGATGG - Intergenic
943687835 2:190837805-190837827 AGGAGGAAGAAAAAAAATGAGGG + Intergenic
944104236 2:196062238-196062260 AGGAGGAAGAGAAGATATGAGGG - Intronic
945050355 2:205818281-205818303 AGGATGAATTTGAGTAATGAAGG - Intergenic
945197320 2:207249448-207249470 AAGAGAATGGTAAGCAATGAGGG + Intergenic
945494683 2:210495954-210495976 GGGAGGAAGGTAAGGAAGGAGGG - Intronic
946890994 2:224276302-224276324 GGGAGGTAATTAAGCCATGAGGG + Intergenic
947343882 2:229170830-229170852 CGGAGGAAGATAAGCACTCAGGG - Intronic
948242339 2:236448169-236448191 AGGGGGATGTTAAGCTTTGAGGG - Intronic
948955777 2:241289726-241289748 AGAAGGAAGATCAGTAATGAGGG + Intronic
1168764361 20:371811-371833 TGGAGGAAGTTGAGGGATGAAGG - Intronic
1169488723 20:6054069-6054091 AGGAGGGAGCTGAGCAATGAGGG - Intergenic
1169874011 20:10276572-10276594 AGAAGAAAATTAAACAATGAAGG - Intronic
1169993416 20:11528876-11528898 AGGAAGATGGAAAGCAATGAAGG + Intergenic
1170136925 20:13084792-13084814 AGGATTAAATTAAGCAATCATGG + Intronic
1170216755 20:13899642-13899664 AGGAGGTGATTAAGCCATGAGGG - Intronic
1170933047 20:20786169-20786191 AGTAGGCAATTAAACAATGATGG + Intergenic
1171370062 20:24656679-24656701 AGGAGGAAGCGAAGCAGAGATGG - Intronic
1171386415 20:24772075-24772097 AGGGGGAGGTGAAGCAAGGAGGG + Intergenic
1173200867 20:40954297-40954319 AGGAGCATGGTAAGAAATGAGGG + Intergenic
1173414497 20:42843710-42843732 AGGAGGAAAGTAAGCATGGAGGG + Intronic
1174018992 20:47514021-47514043 AGGAGGCAGCTAAGAAAGGACGG + Intronic
1174355260 20:49993560-49993582 AAGAGGAACTTCAGCAAGGAGGG - Intergenic
1176821011 21:13656642-13656664 ATGAGGAATTTCAGCAAAGATGG - Intergenic
1177343859 21:19842930-19842952 AGAAGGAAGTTATGAAATGAGGG - Intergenic
1177530248 21:22349595-22349617 AGGAGGTAATTAAGTCATGAGGG + Intergenic
1177642562 21:23862346-23862368 ATGTGGAAGGCAAGCAATGAAGG + Intergenic
1178460197 21:32795944-32795966 AGGAAGAAATGAAGAAATGAAGG - Intronic
1178876490 21:36418339-36418361 AGGAGGATGTCAATCAGTGACGG - Exonic
1179128761 21:38615472-38615494 AGGAGGCAGTAAAGCAAAAAGGG + Intronic
1180620021 22:17155027-17155049 AGGAGGGAGATAAGCAAAGCAGG + Intronic
1180888384 22:19265577-19265599 AGGAGGAAATGAAGCTATGCTGG + Intronic
1181907288 22:26209530-26209552 AAGAGGAAGTCAAGGAAGGAGGG + Intronic
1181980257 22:26761081-26761103 AGGAGGAAGTGGAGGAAGGAGGG + Intergenic
1181981368 22:26769176-26769198 AGGAGGAAGTGATGCCATCAGGG + Intergenic
1182031579 22:27163234-27163256 AGGAGGAAGGGAAGGAAGGAAGG + Intergenic
1182095152 22:27621002-27621024 AGAAGGAAGTTCAGCAAGGCTGG - Intergenic
1182178202 22:28315416-28315438 AGGAGGAATCTAAGCAAAAATGG - Intronic
1183846221 22:40542709-40542731 AGGAGAAAGTAAATAAATGATGG + Intronic
950622707 3:14218750-14218772 AGGAGGAAGGAAAGGAAGGAAGG - Intergenic
950688039 3:14632872-14632894 AGGAGAAAGCTAAGCAGGGAAGG - Intergenic
951549551 3:23863342-23863364 GGGAGGTAGTCAAGCAAGGAAGG - Intronic
951818493 3:26782948-26782970 AGGACAAAGTTAAGCCATGTAGG - Intergenic
952138543 3:30452413-30452435 AGGAGGAGGGTAAGGAAGGATGG - Intergenic
952724764 3:36572474-36572496 AGGAGGAAATTAGGTCATGAGGG - Intergenic
953107021 3:39892306-39892328 AGGTGGAATTTAAGAATTGAAGG + Intronic
953331505 3:42057337-42057359 AGGAAGAAGGGAAGGAATGAAGG + Intronic
954365180 3:50141958-50141980 AGGAGGGAGGGAAGGAATGAGGG - Intergenic
954674275 3:52307108-52307130 AGGAGCACTTTAAGCCATGACGG - Intergenic
955391779 3:58527184-58527206 AGGAGGTAATTAAGTCATGAGGG + Intronic
955837542 3:63073123-63073145 AGGAGGAAGAAAAGGAAGGAAGG + Intergenic
956392656 3:68789970-68789992 TGGAGGAAGAAAATCAATGAAGG + Intronic
956469536 3:69552019-69552041 AGGAGTTAGCTAAGCAAAGAGGG - Intergenic
956564819 3:70624562-70624584 AGGAGGAATTGAAGCAATATTGG - Intergenic
956685707 3:71825468-71825490 AGCAGGAATTCAAGCAGTGAGGG + Intergenic
956785360 3:72637808-72637830 AGGAGGAAGGAAAGAAAGGAGGG + Intergenic
958443916 3:94191802-94191824 AGGATGATATTAAGAAATGAAGG + Intergenic
958588026 3:96116984-96117006 AGGAGGTAATTAAACAATGGAGG + Intergenic
958994513 3:100888111-100888133 AGGAGCAAGCTAATCAATGATGG - Intronic
959102910 3:102033840-102033862 AGGAGGAAGTGAGGTAATTAAGG + Intergenic
959146797 3:102556647-102556669 AGGAGGACATTGAGCATTGAGGG + Intergenic
959260045 3:104066811-104066833 AGAAGGAAGATAAGGAATGCAGG + Intergenic
959356570 3:105337836-105337858 AGGAGGTAGTTAGGTCATGAGGG + Intergenic
959932104 3:111996360-111996382 AGGAGGGTGTTAAGGAATCAGGG - Intergenic
960079621 3:113527433-113527455 AGGAAGAAGTTGAGCAAAGATGG + Intergenic
961554419 3:127688420-127688442 CGGAGGATGTTAAGCAGAGAAGG + Intergenic
961660252 3:128464858-128464880 AGGAGGAAATGAAGGAAGGAGGG - Intronic
961763794 3:129192329-129192351 AGGTGAATGTTGAGCAATGAAGG + Intergenic
962360755 3:134740852-134740874 GAGAGGAAGTTCAGCAATGGAGG + Intronic
962393991 3:134998924-134998946 AGGAAGAAGATAAGCCAGGAAGG + Intronic
962848202 3:139288964-139288986 AGGAGGGAGGGAAGCAACGATGG + Intronic
963501904 3:146137869-146137891 ATGAGGAGGTTAAACAATGAAGG + Intronic
965428571 3:168558770-168558792 AGGAAAATGTTAAGCATTGAGGG + Intergenic
966434419 3:179867487-179867509 AGGAGGGAGTGAAACAAAGATGG - Intronic
966482062 3:180421432-180421454 GGAAGGAAGTTAAGAAATGTGGG + Intergenic
968930781 4:3577525-3577547 AGGAGAAAAACAAGCAATGAAGG + Intronic
970274103 4:14379026-14379048 AGGAGGTAATTAAGTCATGAGGG + Intergenic
971295127 4:25381610-25381632 GGGACAAAATTAAGCAATGAAGG - Intronic
971650501 4:29265918-29265940 AGGAGGAACTTATACACTGATGG - Intergenic
971763747 4:30803058-30803080 AGAAGGAAGTGAAGCCAGGAAGG + Intronic
972207247 4:36789664-36789686 ATGAGGATGTGAAGCAATGTGGG - Intergenic
973256869 4:48122380-48122402 TGGAGGGAGTTAAGAAAGGAGGG - Intronic
974605388 4:64144332-64144354 AGGAGGAAGCTAAGAACAGAGGG + Intergenic
974687424 4:65247973-65247995 AGAAGGAAATTAGGCCATGAGGG + Intergenic
974820269 4:67058566-67058588 AGGAATAAACTAAGCAATGAAGG + Intergenic
974941263 4:68471356-68471378 AGGAGGAAGTGAAGAAAGGAGGG - Intronic
975237261 4:72013818-72013840 TGGAGGAACTGGAGCAATGAAGG - Intergenic
975381825 4:73709510-73709532 TGGAATAAGTTAAGCAATGGTGG - Intergenic
975383731 4:73731348-73731370 AGGAGGAAGGGAAGCAAAGCAGG - Intergenic
975472778 4:74790115-74790137 AGCAGGAATTTGAGAAATGAAGG + Intronic
975530340 4:75393785-75393807 TGGAGGAAGAAGAGCAATGATGG - Intergenic
975892568 4:79046872-79046894 AGGAGGAAGGAAAGGAATCAAGG - Intergenic
976355358 4:84110868-84110890 AGGAGGAAGGGAAGGAAGGAAGG - Intergenic
976434725 4:85004114-85004136 AGGAGGTGATTAAGTAATGAGGG + Intergenic
979268702 4:118733999-118734021 AGGAGAAAGTTAAACAATATAGG - Intronic
979333055 4:119438579-119438601 AGGAGGAAGGGAAGGAAGGAGGG + Intergenic
981028796 4:140102885-140102907 AGTAGGAAGTAAAGGAAAGAAGG + Intronic
981277714 4:142921430-142921452 AGGAAGAAATAAAGGAATGAAGG + Intergenic
981672226 4:147300091-147300113 AGGGGGAAGTAAATCAAAGAAGG + Intergenic
982025637 4:151251609-151251631 AGGAGGAAAGTAAGCAATGAAGG - Intronic
982232399 4:153221667-153221689 GGGAGGAAGGTAAGGAAGGAAGG + Intronic
982357121 4:154483215-154483237 AGAAGGAACTAAAGCAAGGAGGG + Intronic
982375427 4:154685207-154685229 AGAAGGTAGTTAAGCAAAGGGGG - Intronic
982541603 4:156679051-156679073 AGGAGAATGGTAAGAAATGAAGG - Intergenic
982814669 4:159869737-159869759 AGGAGGTTGTTATGCAATTAAGG - Intergenic
983735211 4:171049847-171049869 ATGGGTAAGTTAAGCAATAAAGG + Intergenic
984149705 4:176111517-176111539 ATGAGGAAGTTTATCAATAATGG + Intronic
986129376 5:4912744-4912766 AGGAAGAAGGAAAGAAATGAAGG + Intergenic
986868047 5:12013159-12013181 AGGACAAGGTTAAGGAATGACGG + Intergenic
987070210 5:14329350-14329372 AGGAGGGAATTAGGCCATGAGGG + Intronic
987727436 5:21720302-21720324 AAGAGGAAGCCAATCAATGAAGG + Intergenic
987754113 5:22078239-22078261 AGGAAGAATTAAAGCAAAGAGGG + Intronic
988718093 5:33847740-33847762 AGCAGTAAGTTAGGCAAAGAGGG + Intronic
989110661 5:37903960-37903982 AGGAGGTAATTAGGCTATGAAGG + Intergenic
989793777 5:45441355-45441377 AGGAGGGAGGGAAGCAAAGAAGG + Intronic
990352398 5:54931794-54931816 AGGAGGAAGTCAGACAGTGAAGG - Intergenic
991624033 5:68579289-68579311 AGGAGGAGGAGGAGCAATGAAGG - Intergenic
991624096 5:68580285-68580307 AGGAGGACGAGGAGCAATGAAGG + Intergenic
992786731 5:80177138-80177160 GGGAGGTAGATAGGCAATGATGG + Intronic
993102764 5:83561422-83561444 AAGAAGAATTTAAGTAATGAAGG - Intronic
993407531 5:87529905-87529927 AGGAAGAAGGGAAGGAATGAAGG - Intergenic
993598347 5:89888208-89888230 AGGAGGCAATTAAGTCATGAGGG + Intergenic
993601255 5:89927842-89927864 ATGTGGGAGTTAAGCTATGAGGG + Intergenic
994046289 5:95314056-95314078 AGGAGGAAATTAAAGATTGAAGG + Intergenic
994306216 5:98208004-98208026 AGGAGGTAGTTAAACCATGGGGG - Intergenic
994912065 5:105923046-105923068 AGAAGCTAGTTAAGCAGTGATGG - Intergenic
995511947 5:112919240-112919262 AGGAGGCAATTAAGACATGAGGG + Intronic
995609567 5:113894574-113894596 AGGAGGAACTTAATAAATTATGG + Intergenic
996796136 5:127350486-127350508 AGGAGGAAGAGAACCAAGGAAGG - Intronic
997734341 5:136202585-136202607 ATGAGGCACTTAAGGAATGAGGG - Intergenic
997790480 5:136755221-136755243 AGGACTAAGTCAAGCAGTGAGGG - Intergenic
998145537 5:139725669-139725691 AGAAGGAAGAGAAGCAGTGAAGG - Intergenic
998371635 5:141665664-141665686 AGGAGAAAGGAAAGCAGTGAGGG + Intronic
999519335 5:152334494-152334516 AGGAAGAAGTTAAACCATGCGGG + Intergenic
1000049295 5:157548151-157548173 AGGAGGAAGTAAAGAAAAGGGGG - Intronic
1000263617 5:159614005-159614027 AGGAGGTGATTAAGCGATGAGGG + Intergenic
1001417503 5:171556152-171556174 AGGAGGAAGTAAAGGGATGAGGG - Intergenic
1002193517 5:177490704-177490726 AGGAGGAAGGGAAGGAAGGAAGG + Intronic
1002212098 5:177605150-177605172 AGGAGGAAGTAAAGACAAGAAGG - Intronic
1003253756 6:4456683-4456705 AGGAGGTAATTAGGCCATGAAGG - Intergenic
1003300494 6:4876919-4876941 GGGAGGAGGTTAGGCCATGAGGG + Intronic
1003483337 6:6553352-6553374 AAGAGGAATTTAAAAAATGAAGG + Intergenic
1004536892 6:16511787-16511809 AGGAGGAAGATAAGCGAGGCTGG + Intronic
1005261806 6:24069235-24069257 AAGAGGAGGCTAAGCAATAAAGG - Intergenic
1005398174 6:25405023-25405045 AGGAGGAAGTGAAACGTTGACGG - Intronic
1005500073 6:26421792-26421814 AGGAGGAAGTGAAGGGAGGAGGG + Intergenic
1005504549 6:26458310-26458332 AGGAGGAAGTGAAGGGAGGAGGG + Intronic
1005830132 6:29664108-29664130 TGGAGTAGGTTGAGCAATGAGGG - Intronic
1007981111 6:46158983-46159005 AGGAGGATGTTGAGAAAAGATGG + Intergenic
1008904341 6:56659629-56659651 AGTATGAAGTGAAGAAATGATGG + Intronic
1010643707 6:78361778-78361800 AGGAGCAAGTGAGGCACTGAGGG - Intergenic
1010994721 6:82520156-82520178 GGGAGCAAGTTAATCAATTATGG + Intergenic
1011809679 6:91116470-91116492 AGGAGAAAATTAAGAAATGTGGG - Intergenic
1013615981 6:111843621-111843643 GGGAGCAAGTCAAGGAATGATGG + Intronic
1013757657 6:113480408-113480430 AGGACGAAGTAAAGGCATGAGGG + Intergenic
1014892417 6:126858960-126858982 AGGAGGAAGATAAATAAAGAAGG - Intergenic
1015851161 6:137574101-137574123 AGAAGGAAGTTAAGCCAGGAAGG + Intergenic
1016071529 6:139744939-139744961 AGGAGGAAGGGAAGCAGAGAAGG + Intergenic
1017236504 6:152122253-152122275 AGGTGGAAGATAAACAGTGACGG - Exonic
1017401613 6:154070786-154070808 AGGAGGAAATTAACAAATCAAGG + Intronic
1017613433 6:156215763-156215785 TGGAGGAAGTAGAGCAATGTTGG + Intergenic
1017693829 6:156994447-156994469 TGGAGGAAGTAAATCAATAACGG - Intronic
1018540824 6:164877386-164877408 CGGAGGTAGTTAAGTCATGAGGG - Intergenic
1018551746 6:165006337-165006359 AGAAGGATATTAAGCAATGATGG - Intergenic
1019332371 7:466753-466775 AGGAGGAAGATGAGGGATGAGGG - Intergenic
1019776152 7:2913134-2913156 AGGAGGAAGGAAAGGAAAGAGGG + Intronic
1020128906 7:5548769-5548791 AGGAGGAAGGGAAGGAAGGAAGG + Intronic
1020590045 7:10124151-10124173 AGGAGGTAATTAGGCCATGAGGG - Intergenic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1021153605 7:17181819-17181841 AGGAAGAAGAAGAGCAATGAAGG - Intergenic
1021414396 7:20365532-20365554 AGGATGAAATGAAGCAATGTGGG + Intronic
1021758046 7:23874982-23875004 GGGAGGAAGGTAAGCAAAGTTGG + Intergenic
1022360552 7:29652625-29652647 GGGAGAAAGTTCAGGAATGAAGG + Intergenic
1022499776 7:30875382-30875404 AGAAGGAAGGAAAGCAAGGAGGG - Intronic
1022752355 7:33243216-33243238 AGGAGGAAATTAAACAAGGAAGG - Intronic
1023120408 7:36903188-36903210 AGGAGGAAGGGCAGGAATGAAGG - Intronic
1023134389 7:37036723-37036745 AGGAGGAAGTCCACCAATGGGGG + Intronic
1023593088 7:41799503-41799525 AGGAGGAAGTTAAACCACAAAGG - Intergenic
1024116823 7:46202182-46202204 AGGAGGAAGTGAAGAGGTGACGG - Intergenic
1026044206 7:66894586-66894608 AGGAGGAAGGAAAGGAAGGAAGG + Intergenic
1026927614 7:74204824-74204846 AGGCGGCAGTGGAGCAATGAAGG - Intronic
1027823038 7:83072885-83072907 AGGAAGGAGTCAAGCAATTATGG - Intronic
1027870224 7:83697173-83697195 AGGAGGAAGTAAAGACTTGATGG - Intergenic
1029572239 7:101377769-101377791 ATGAGGGACTAAAGCAATGAAGG - Intronic
1030271145 7:107669500-107669522 AGAAGGAAGATAAGAAAAGAAGG - Intronic
1030533787 7:110741406-110741428 AGGAGGTAATTATGCCATGAGGG + Intronic
1030789899 7:113711223-113711245 AGCAGAAAGTTAAGCAAGAAAGG - Intergenic
1030806958 7:113930538-113930560 AGGAGGAAGTTATTGAATCATGG + Intronic
1030900569 7:115118465-115118487 AGGAGGAAGTGAAGAAAGAATGG - Intergenic
1031907169 7:127473364-127473386 AGGAAGAAGAAAAGGAATGACGG + Intergenic
1031956332 7:127946126-127946148 AGTAGGAAGTGTAGTAATGAAGG + Intronic
1032236735 7:130130934-130130956 AGGAGGAACAGAAGCAAAGAAGG - Exonic
1032870911 7:135984177-135984199 AGGATGAAGTAAAACAATCATGG + Intergenic
1034554139 7:151839285-151839307 AGGAGGAAGTCAAGTGATGCTGG + Intronic
1034585749 7:152090876-152090898 AGAAGGAAGTAAAGCCATTATGG + Intronic
1035899937 8:3448389-3448411 AGGAGGAAGGGAAGGAAGGAAGG + Intronic
1037336743 8:17800188-17800210 AGGAGGAAGGGAGGCAATGCAGG - Intronic
1038982476 8:32775078-32775100 AGGAGGAAGAAGAGAAATGAAGG - Intergenic
1039314495 8:36356503-36356525 AGGAGGAAGGGAAGGAAGGAAGG + Intergenic
1039781674 8:40792611-40792633 GGGAGGAAGTGAAGGAAGGAAGG + Intronic
1040015320 8:42694909-42694931 GGAAGGAAGTAAAGCATTGATGG + Intergenic
1043834114 8:85026960-85026982 AGGAGGAAGGGAAGGAAGGAAGG + Intergenic
1043953986 8:86341039-86341061 GGGAGGAAATTGAGCAATGAGGG + Intergenic
1044145944 8:88713946-88713968 AGGTGGAACTTGAGCAATTATGG + Intergenic
1046266120 8:111832388-111832410 AGAAGGAAGTCAAAGAATGAAGG + Intergenic
1046619579 8:116514142-116514164 AGGAGGAATGTGAGAAATGATGG - Intergenic
1046886150 8:119369396-119369418 AGGAGGTAATTAAGTCATGAAGG + Intergenic
1048199292 8:132358444-132358466 AGGAAGAAGTCAACCAAAGAAGG + Intronic
1050203016 9:3168464-3168486 AGGACCAAGTCAAGCAGTGAAGG + Intergenic
1050486831 9:6143176-6143198 TGGAGGAAGCTATGGAATGAAGG - Intergenic
1051226787 9:14907883-14907905 ATGAGGAAGTGAAGCTTTGAGGG + Intronic
1051591488 9:18780182-18780204 AGGAGGTAGACAAGCATTGAGGG + Intronic
1051909328 9:22134977-22134999 AGGAGAAAATGAAGCAATGCAGG - Intergenic
1054459339 9:65454389-65454411 AGGAGAAAAACAAGCAATGAAGG - Intergenic
1054720826 9:68602091-68602113 AAGAGGACTTTAAGGAATGAGGG + Intergenic
1054935824 9:70686729-70686751 AGGAGGAAGGGAAGGAAGGAAGG - Intronic
1055328623 9:75159034-75159056 AGGAGGAAATTTAGAACTGAGGG + Intergenic
1056901362 9:90603017-90603039 AGCAGTAATTTAAGAAATGAAGG - Intergenic
1057944011 9:99308971-99308993 AGGAGGTGGTTAAAGAATGATGG - Intergenic
1058051422 9:100410704-100410726 AAGAGGAATTTATGCAATAATGG + Intergenic
1058372329 9:104284326-104284348 ATGAGGAAATTGAGCAATGGAGG - Intergenic
1060602535 9:124887848-124887870 AGGAGGGGGTTATGAAATGAAGG - Intronic
1185725969 X:2422232-2422254 AGGAAGAAGTCAATCAATAATGG + Intronic
1185766899 X:2732909-2732931 AGGAGGAAGGGAAGGAAGGAAGG - Intronic
1185772196 X:2773298-2773320 AGGAGGAAGGGAAGAAAGGAGGG + Intronic
1186145648 X:6621672-6621694 GGGAGGAAGTGAAGAAAAGAAGG + Intergenic
1187919895 X:24191422-24191444 AGGAGGAAGTTAAGAGAGGAAGG + Intronic
1188354001 X:29167336-29167358 AGGAGGAAGTGAGGAAAGGAGGG - Intronic
1190158094 X:48009781-48009803 TGGAGGAAGTGACGGAATGAGGG - Intronic
1190173865 X:48132665-48132687 TGGAGGAAGTGACGGAATGAGGG - Intergenic
1190522322 X:51292991-51293013 AGGGGCAAGTTAAGCAGTGGGGG + Intergenic
1190973469 X:55376010-55376032 AAGAGGTGGTTAAGCCATGAGGG - Intergenic
1191180178 X:57553873-57553895 AAGTGGAAGCTAAGCTATGAGGG + Intergenic
1192180050 X:68910774-68910796 AGGAGGAGGTTAGGCTAGGAAGG - Intergenic
1193347527 X:80422071-80422093 GGGAGAAAGTTCAGCAATGAAGG + Intronic
1195121150 X:101753901-101753923 AGCAGGAAGCTTAGGAATGAGGG + Intergenic
1195222836 X:102762859-102762881 AGGAGGTAGTTAGGCCATGAAGG - Intergenic
1195619357 X:106937647-106937669 AGGAGGTAGTTAGTTAATGATGG - Intronic
1195726959 X:107927840-107927862 AGGAGGGAGGAAGGCAATGATGG - Intergenic
1196436587 X:115680354-115680376 GGGAGGCAGTTAAGCCATGACGG + Intergenic
1197612232 X:128652734-128652756 AGGAGGTAATTAAGTGATGAAGG + Intergenic
1197992098 X:132329380-132329402 AGGAGGTAATTAGGCCATGAGGG - Intergenic
1198780661 X:140232120-140232142 AGGAGGTAATTCAGCCATGAGGG - Intergenic
1200420464 Y:2960183-2960205 TGGGTGCAGTTAAGCAATGAAGG - Intronic
1201922022 Y:19244138-19244160 AGGAAGAAGTGAAGGAAGGAAGG + Intergenic