ID: 1072800239

View in Genome Browser
Species Human (GRCh38)
Location 10:98387803-98387825
Sequence TTTATGTTTTTAGTAGCTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072800236_1072800239 -10 Left 1072800236 10:98387790-98387812 CCCTGCTAATTTTTTTATGTTTT 0: 3
1: 146
2: 4686
3: 74759
4: 230626
Right 1072800239 10:98387803-98387825 TTTATGTTTTTAGTAGCTACGGG No data
1072800233_1072800239 26 Left 1072800233 10:98387754-98387776 CCTGAGCAGCTAAGATTACAGGC 0: 3
1: 416
2: 11190
3: 104073
4: 238739
Right 1072800239 10:98387803-98387825 TTTATGTTTTTAGTAGCTACGGG No data
1072800235_1072800239 -5 Left 1072800235 10:98387785-98387807 CCACACCCTGCTAATTTTTTTAT 0: 22
1: 1323
2: 36292
3: 102995
4: 171540
Right 1072800239 10:98387803-98387825 TTTATGTTTTTAGTAGCTACGGG No data
1072800234_1072800239 -2 Left 1072800234 10:98387782-98387804 CCACCACACCCTGCTAATTTTTT 0: 373
1: 17957
2: 95352
3: 185287
4: 213169
Right 1072800239 10:98387803-98387825 TTTATGTTTTTAGTAGCTACGGG No data
1072800231_1072800239 29 Left 1072800231 10:98387751-98387773 CCTCCTGAGCAGCTAAGATTACA 0: 4
1: 320
2: 8934
3: 77945
4: 170554
Right 1072800239 10:98387803-98387825 TTTATGTTTTTAGTAGCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072800239 Original CRISPR TTTATGTTTTTAGTAGCTAC GGG Intronic
No off target data available for this crispr