ID: 1072802118

View in Genome Browser
Species Human (GRCh38)
Location 10:98399534-98399556
Sequence CAGGATGAACACATGTCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072802118_1072802126 20 Left 1072802118 10:98399534-98399556 CCATCCGACATGTGTTCATCCTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1072802126 10:98399577-98399599 CATGGACACTTTGTTGCCTTGGG No data
1072802118_1072802127 28 Left 1072802118 10:98399534-98399556 CCATCCGACATGTGTTCATCCTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1072802127 10:98399585-98399607 CTTTGTTGCCTTGGGCAGCCAGG No data
1072802118_1072802121 2 Left 1072802118 10:98399534-98399556 CCATCCGACATGTGTTCATCCTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1072802121 10:98399559-98399581 ACCAGACCTGCACACCATCATGG No data
1072802118_1072802125 19 Left 1072802118 10:98399534-98399556 CCATCCGACATGTGTTCATCCTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1072802125 10:98399576-98399598 TCATGGACACTTTGTTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072802118 Original CRISPR CAGGATGAACACATGTCGGA TGG (reversed) Intronic
900795942 1:4708470-4708492 CATGATGAACAGATTTCGGGAGG - Intronic
906975043 1:50561199-50561221 CAGGATGAACTCATCTGGGTTGG + Intronic
915278991 1:154809593-154809615 CAGGCTCATCACATGTGGGAGGG + Intronic
1063669868 10:8091465-8091487 CAGGTTAGTCACATGTCGGATGG + Intergenic
1063925432 10:10972906-10972928 CAGGATGATCACATGATAGATGG + Intergenic
1063987456 10:11520552-11520574 GAGGATGAACACATGCCTGCAGG + Intronic
1067458608 10:46441074-46441096 CAGGATGAACACAGGAGGGCTGG + Intergenic
1067628588 10:47943562-47943584 CAGGATGAACACAGGAGGGCTGG - Intergenic
1071343239 10:84667248-84667270 CAGGAAGGACACATATGGGATGG + Intergenic
1071477144 10:86034790-86034812 CTGGATGAACAGATGTATGATGG + Intronic
1072802118 10:98399534-98399556 CAGGATGAACACATGTCGGATGG - Intronic
1074609037 10:115003807-115003829 CAGGAAGCACACAGGTGGGATGG + Intergenic
1077280498 11:1742872-1742894 GAGGATGAACAGATGATGGATGG + Intronic
1080261290 11:30352395-30352417 CAGGATTAGCACATGTGGGCTGG + Intergenic
1080615880 11:33944499-33944521 CTGGATGGAGACATCTCGGAAGG - Intergenic
1081530943 11:43958961-43958983 GGGGATGAACACATGGCAGAAGG + Intergenic
1084876299 11:72136143-72136165 CAGCATGCACACAGGTCAGAGGG + Intronic
1084881271 11:72173212-72173234 CAGCATGCACACAGGTCAGAGGG + Intergenic
1093071725 12:14712740-14712762 AAGGATGAACAAATGTCTGATGG + Intergenic
1098659286 12:73072539-73072561 CAGGATGCCCACATGTCAGCTGG + Intergenic
1104063894 12:125290573-125290595 CAAGATGAACACATTGCGGAAGG - Intronic
1110029356 13:70586704-70586726 TAGGATGAACAACTGTAGGATGG + Intergenic
1113048708 13:106184931-106184953 CAGGATGAGCACATGACCCAAGG + Intergenic
1120969539 14:90195991-90196013 CTTGATAAACACATGTAGGATGG + Intergenic
1124631630 15:31340978-31341000 CAGGATGAACACAGGGCACAGGG - Intronic
1127305627 15:57703086-57703108 CAAGAAGAACACATTTAGGATGG + Intronic
1127924788 15:63528667-63528689 CAGGATAAACACATTTCCCATGG - Intronic
1130889842 15:88124383-88124405 CAGCATGTCCCCATGTCGGATGG - Intronic
1131693130 15:94847405-94847427 CAGGATAATCAGATGTAGGAGGG - Intergenic
1133443549 16:5840624-5840646 CAGAATGAAAACATGTCAAAAGG + Intergenic
1137967761 16:52953531-52953553 CAGGATGAACCCCTGTGGAAAGG + Intergenic
1138901143 16:61272454-61272476 CAGGATGAACAAATGAGAGATGG + Intergenic
1142014905 16:87740279-87740301 CGGGATGCACACATGTCGGGTGG - Intronic
1147553995 17:41464750-41464772 CAGGATGAACACAGGTGGGGAGG - Intronic
1151138927 17:71973285-71973307 CAGGATGAACAGACGTCTGCAGG + Intergenic
1154290140 18:13099245-13099267 CAGCATGAACCCATGACGCAAGG - Intronic
1156042210 18:32835380-32835402 AAGGAGGAGCACATGTGGGAGGG + Intergenic
1159120384 18:64162387-64162409 CAGGGTGAGCACATTTCTGAGGG - Intergenic
1159455800 18:68659064-68659086 GAGGATGAAGACATGTTAGAGGG + Intergenic
1165182909 19:33988011-33988033 CAGCTTGAACACAGGTCGGGGGG + Intergenic
1167294288 19:48640236-48640258 CAGGAAGGAGACATGTCGGCCGG + Exonic
926731137 2:16036614-16036636 CAGGTGGAAGACATGTCAGAAGG - Intergenic
926793824 2:16602479-16602501 CAGTATGAACATATGTCAAAGGG + Intronic
927056470 2:19369935-19369957 CAGGATGAACACAAGTTCTATGG + Intergenic
929226590 2:39517120-39517142 AAGGAAGAAAACATGTCTGAGGG + Intergenic
933507950 2:83203098-83203120 CAGGATGAACACATCTGAGTTGG - Intergenic
935355644 2:102197068-102197090 AAGGAGGAACTCATGTCTGAGGG + Intronic
936077477 2:109410875-109410897 TAGGATGAACATCTGTCTGAGGG + Intronic
936497679 2:113036622-113036644 CAGGAAGAACACATTTCTGTGGG + Intronic
937970585 2:127545998-127546020 CAAGAAGAACACAGGTTGGAAGG - Intronic
942200611 2:173567379-173567401 CAGGAGGAAAACATGGTGGAGGG + Intergenic
944877263 2:203975027-203975049 CAGGATGTACAAATGTTGGAGGG + Intergenic
949081068 2:242100195-242100217 CAGGATGAATGGATGTCTGAGGG + Intergenic
1170268178 20:14491986-14492008 CATGATGAACCCATGTCTGTAGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1174252385 20:49229324-49229346 CACTATGAAAACATGTCGGCTGG - Intronic
1176107753 20:63397630-63397652 CAGGATGAGCACTTGAGGGAGGG - Intergenic
1180087607 21:45514977-45514999 CAGGATGGACACACTTCAGAAGG + Exonic
1181901718 22:26161493-26161515 CAGCATGAACAAATGTGGGTTGG + Intergenic
1184216321 22:43069808-43069830 AACGCTGAACACATTTCGGATGG + Exonic
949643245 3:6063916-6063938 CAGGAAGAACAAAGGTGGGATGG + Intergenic
949866362 3:8550652-8550674 CAGGAAGAATACATGTCCTAAGG + Intronic
950543038 3:13623498-13623520 CGGGATGAACACGTGTGCGAGGG - Intronic
952697790 3:36290186-36290208 CATGATGAGCAAATGTCAGAGGG - Intergenic
955875809 3:63489250-63489272 CAGCCTGAACACTTGCCGGATGG - Intronic
961449810 3:126997588-126997610 CAGGAAGCACAGATGTCGGCAGG - Intronic
962288065 3:134105264-134105286 CTGGAGGAACACATGGCTGAAGG + Intronic
966325427 3:178747857-178747879 CAGGGTGAACACCTGTCATAAGG - Intronic
970172448 4:13303418-13303440 CAAGATGCACACAAGTGGGATGG - Intergenic
970355585 4:15248527-15248549 CAGGATGAACAGATATCTAACGG + Intergenic
977309066 4:95362294-95362316 CAGGATGAGCACATGACCCAAGG + Intronic
979223742 4:118261177-118261199 CAGGATGATCACAAGTGGGAGGG - Intergenic
979928189 4:126594485-126594507 CAGGACAAACTCATGTAGGATGG - Intergenic
980997510 4:139794310-139794332 CAGGAAGGCCACATGTGGGAAGG + Intronic
982829335 4:160041790-160041812 CAGGATGAAAAGATGGCAGAAGG + Intergenic
985236734 4:187883471-187883493 TAGGATTAACACCTGTAGGAGGG - Intergenic
986942903 5:12977634-12977656 AAGGATGATCACATATGGGATGG - Intergenic
987265088 5:16245187-16245209 CAGGAAGAAAAAATGTGGGATGG - Intergenic
994950174 5:106451845-106451867 CAGGATAAACCCATGTAGAATGG - Intergenic
1003467997 6:6399726-6399748 CAGGGTGAACTCATGTGAGATGG - Intergenic
1007564028 6:42834744-42834766 CATGATGGAAACATGTCAGAAGG - Intronic
1011878559 6:91993310-91993332 CAGGATAAATGCATGTGGGATGG + Intergenic
1012502333 6:99902714-99902736 CTGGCTGAACACTTGTTGGAAGG + Intergenic
1013685018 6:112570541-112570563 CAGCATCATCACATGACGGAGGG - Intergenic
1020618061 7:10484622-10484644 AAGGATGACCACAGGTAGGAGGG - Intergenic
1026793890 7:73353456-73353478 CAGGATGATCTCATCTGGGACGG - Intronic
1027615415 7:80417391-80417413 CAGAATGAACCGATGTCTGAAGG + Intronic
1032700014 7:134371041-134371063 CAGGAAGAACGCATGGCGGAAGG - Intergenic
1034386110 7:150742564-150742586 GAGGATGACCACATGTCTCATGG - Exonic
1036280412 8:7395562-7395584 CAGGATGAACACTGCTCTGAAGG - Intergenic
1036341058 8:7916008-7916030 CAGGATGAACACTGCTCTGAAGG + Intergenic
1038636241 8:29289631-29289653 CAAGATGAACACCTGTGAGAGGG - Intergenic
1040493027 8:47942308-47942330 CAGGGGGAACACAAGTCTGACGG + Intronic
1043728519 8:83644625-83644647 CAGGATGATCAGATGTCACATGG + Intergenic
1046793292 8:118344214-118344236 CAGGTTGAACTAATGTGGGAAGG + Intronic
1048229331 8:132621406-132621428 GGGGATGATCACATGTCGGGAGG + Intronic
1054814609 9:69463050-69463072 CAGAATGAACACATTAGGGAGGG + Intronic
1058342029 9:103909527-103909549 CAGCATGAGCACCTGTCTGAGGG - Intergenic
1060314029 9:122491726-122491748 CAGGATGTACACATGGTGGATGG + Intergenic
1188148919 X:26648816-26648838 CAACATGAACACATGTGGAATGG + Intergenic
1189519239 X:41748562-41748584 CAAGATGAAAACATATAGGAGGG + Intronic
1190623850 X:52316925-52316947 CATGATCAACACATGGCGAATGG + Intergenic
1198951427 X:142076703-142076725 AAGGATGAGCACATATCTGATGG + Intergenic
1199948958 X:152690208-152690230 CAGGATGATCAGATGTCTAAAGG - Intergenic
1199960718 X:152778241-152778263 CAGGATGATCAGATGTCTAAAGG + Intergenic
1201586719 Y:15569208-15569230 CAGGCTGAACAAATGGGGGAAGG + Intergenic