ID: 1072804887

View in Genome Browser
Species Human (GRCh38)
Location 10:98418010-98418032
Sequence CTGTGTGCAGCGAGGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 2, 2: 3, 3: 47, 4: 398}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072804887_1072804899 14 Left 1072804887 10:98418010-98418032 CCGTCCTCCCTCGCTGCACACAG 0: 1
1: 2
2: 3
3: 47
4: 398
Right 1072804899 10:98418047-98418069 GTGTTCCCAGCGTGGATTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 80
1072804887_1072804900 15 Left 1072804887 10:98418010-98418032 CCGTCCTCCCTCGCTGCACACAG 0: 1
1: 2
2: 3
3: 47
4: 398
Right 1072804900 10:98418048-98418070 TGTTCCCAGCGTGGATTTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 121
1072804887_1072804904 26 Left 1072804887 10:98418010-98418032 CCGTCCTCCCTCGCTGCACACAG 0: 1
1: 2
2: 3
3: 47
4: 398
Right 1072804904 10:98418059-98418081 TGGATTTCTGGGTCTGAGGTAGG 0: 1
1: 2
2: 52
3: 581
4: 783
1072804887_1072804898 6 Left 1072804887 10:98418010-98418032 CCGTCCTCCCTCGCTGCACACAG 0: 1
1: 2
2: 3
3: 47
4: 398
Right 1072804898 10:98418039-98418061 CCGGGAAGGTGTTCCCAGCGTGG 0: 1
1: 0
2: 0
3: 14
4: 98
1072804887_1072804895 -8 Left 1072804887 10:98418010-98418032 CCGTCCTCCCTCGCTGCACACAG 0: 1
1: 2
2: 3
3: 47
4: 398
Right 1072804895 10:98418025-98418047 GCACACAGGGCCAGCCGGGAAGG 0: 1
1: 0
2: 3
3: 34
4: 283
1072804887_1072804905 27 Left 1072804887 10:98418010-98418032 CCGTCCTCCCTCGCTGCACACAG 0: 1
1: 2
2: 3
3: 47
4: 398
Right 1072804905 10:98418060-98418082 GGATTTCTGGGTCTGAGGTAGGG 0: 1
1: 0
2: 1
3: 31
4: 254
1072804887_1072804903 22 Left 1072804887 10:98418010-98418032 CCGTCCTCCCTCGCTGCACACAG 0: 1
1: 2
2: 3
3: 47
4: 398
Right 1072804903 10:98418055-98418077 AGCGTGGATTTCTGGGTCTGAGG 0: 1
1: 0
2: 5
3: 71
4: 589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072804887 Original CRISPR CTGTGTGCAGCGAGGGAGGA CGG (reversed) Intronic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900312031 1:2038222-2038244 CTCTGTGCAGCCATGGAGGTCGG - Intergenic
901144098 1:7053625-7053647 CAGAGTGGAGTGAGGGAGGAAGG - Intronic
901445567 1:9305937-9305959 ATGAGTGCAGAGAGGCAGGAGGG + Intronic
901753611 1:11427464-11427486 CTATGTGCAGGGAGGGTGCAGGG + Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
901930866 1:12595580-12595602 CTGGGTGGAGCGGGTGAGGAGGG + Intronic
902727545 1:18347165-18347187 CTGTGTTCAGAGAGGGAGGGAGG - Intronic
903268571 1:22173766-22173788 CTGTCTGCAGAGGGGCAGGAAGG - Intergenic
903275562 1:22219163-22219185 CTGTTTGCAGCCAGGGAGACTGG - Intergenic
904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG + Intergenic
905462951 1:38133412-38133434 CTGTCTGCAGCCAGGGGGAAAGG - Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
905920824 1:41717545-41717567 CTGGGTGAAGTGAGGGAGCAGGG + Intronic
906274891 1:44508129-44508151 CTGTGTGGAGCAGAGGAGGAGGG + Intronic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
907869923 1:58433647-58433669 CTGTGTGGAGGGGGGGAGGCGGG + Intronic
908009110 1:59757584-59757606 CTGTGTCCAGATAGTGAGGAGGG + Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
909573306 1:77142779-77142801 ATGTGTGGAGAGAAGGAGGAAGG - Intronic
910670676 1:89769652-89769674 CTGCCTGCAGTGAGAGAGGAAGG - Intronic
910758356 1:90713379-90713401 GGGTGTGCAGCGGGGGAGGGAGG - Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
913056236 1:115162788-115162810 CTCTGAGGAGGGAGGGAGGAGGG - Intergenic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
914806312 1:150994752-150994774 CTGTGTGCAGGGAGTGAGGGTGG - Intronic
915140465 1:153764771-153764793 GTGTGTGCTGTCAGGGAGGATGG - Intronic
915311571 1:155008132-155008154 CTGTGGGCACCGAAAGAGGAAGG - Intronic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
916317097 1:163461285-163461307 CTTTGTGAAGCCAGGTAGGAAGG + Intergenic
916667694 1:166981483-166981505 ATGTGTGTAGAGAGGGAGGGAGG + Intronic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
917711380 1:177688675-177688697 CTGTGGGAAGTGAGGGAGGGTGG + Intergenic
917930460 1:179819045-179819067 CTGTGTGCTGGGCTGGAGGATGG - Intergenic
918237881 1:182597957-182597979 CTGTGAGCACTGAGGGAGGGAGG - Intergenic
918489842 1:185069698-185069720 GTGTTTGGAGCTAGGGAGGAGGG + Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
921056047 1:211543153-211543175 CTGTGGGCAGTGAGGGTGAATGG + Intergenic
922490664 1:226013970-226013992 CAGTGTGCAGTGCGGGCGGAAGG - Intergenic
922976615 1:229789845-229789867 CTGTTTGCAGGGCAGGAGGAGGG + Intergenic
923668966 1:236023969-236023991 CTGGGTGCAGCAAGGAAGCACGG - Intronic
924612189 1:245582921-245582943 CGGGGTGCAGGGAGAGAGGAAGG - Intronic
1062810323 10:458603-458625 CTGTGTGCTGCCAGTGAGGCAGG - Intronic
1062816987 10:508114-508136 CTCTGTGGCGTGAGGGAGGAAGG - Intronic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063702586 10:8400110-8400132 GTGTGTGAAGTGAGGCAGGAAGG + Intergenic
1064873981 10:19971989-19972011 CGTTGTGCATAGAGGGAGGAAGG + Intronic
1065132428 10:22635665-22635687 CTGTGGGCAGCGAGGAAGCATGG + Intronic
1065553195 10:26889142-26889164 CTTTGGGCAGCCAAGGAGGATGG + Intergenic
1066327893 10:34383799-34383821 CTGTGTGCAGCAAAGGTGGACGG + Intronic
1066402012 10:35085851-35085873 CTTTTTACAGCGAGGGAGGAAGG + Intronic
1067713862 10:48671943-48671965 CTGGGAGCAGCGCGGGAAGAGGG - Intergenic
1069445730 10:68471770-68471792 CTGTGAGCGGAGAGGGGGGAGGG - Exonic
1069984691 10:72275085-72275107 CTGGCTGAAGCCAGGGAGGAAGG - Exonic
1070147577 10:73785888-73785910 ATGTTTGCAGAGTGGGAGGACGG + Exonic
1071083696 10:81842794-81842816 CTTTTTGCAGTGAGAGAGGAAGG - Intergenic
1071481875 10:86070683-86070705 ATGTGTGCAGGGATGGATGAGGG - Intronic
1072716701 10:97757145-97757167 CTGTGTCCAGCCAAGGAGGCTGG + Intronic
1072728252 10:97828011-97828033 CAGTGAGCATCGCGGGAGGATGG + Intergenic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1075455425 10:122581932-122581954 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075457548 10:122594635-122594657 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075458629 10:122601130-122601152 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459260 10:122605189-122605211 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459892 10:122609248-122609270 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075460524 10:122613307-122613329 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1076526783 10:131117123-131117145 CTGTGTTCAGGGTGGGAGGCTGG + Intronic
1076542958 10:131225742-131225764 CTGTGTGCAGGGAGTTGGGAGGG - Intronic
1076820561 10:132936745-132936767 CTCTGTGCTGGGAGGGAGGCAGG + Intronic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077119052 11:898460-898482 CTGGTTGCAACGAGCGAGGATGG - Intronic
1077533630 11:3108538-3108560 CTGTGGGCAGCGGTGGAGCAGGG + Intronic
1077553712 11:3215856-3215878 CTGTGTGCAGCAGGACAGGAAGG - Intergenic
1077702361 11:4454212-4454234 CTGGGTGCAGCAAGGAGGGAAGG - Intergenic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1077915897 11:6611474-6611496 CTGTCAGCAGAGCGGGAGGAGGG + Intronic
1078102937 11:8340453-8340475 CTGTGTGATGCAATGGAGGAGGG - Intergenic
1078737079 11:14030164-14030186 CTGAGTGCTGCGTGGGAGGAGGG - Intronic
1078928582 11:15895925-15895947 CTGTGTTCAGGGAGGGAGTGAGG + Intergenic
1079244786 11:18744098-18744120 CTGAGGGCGGCGAGGGAGGAGGG + Exonic
1080042209 11:27770789-27770811 CTCTGGACAGCCAGGGAGGAAGG - Intergenic
1080787752 11:35491298-35491320 CAGTTTACAGAGAGGGAGGATGG - Intronic
1080935119 11:36855101-36855123 CTATGTGCAGGGAGGGTGGGAGG + Intergenic
1081278878 11:41184038-41184060 CTGTGTGCAGCCTGGGAACATGG - Intronic
1081608605 11:44544370-44544392 CTGTCTGCAGCTAAGGAGTAAGG - Intergenic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1082771427 11:57210796-57210818 CTGTCTGCACCGTTGGAGGATGG - Intergenic
1083290035 11:61684723-61684745 CTGTGGGAAGTGAGGGCGGAGGG + Intronic
1083300268 11:61736395-61736417 CTCTGTGCTGCGTTGGAGGAGGG - Intronic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083589470 11:63884850-63884872 CTGGATACAGTGAGGGAGGAAGG + Intronic
1083657681 11:64237529-64237551 CTGGGTGCAGCGTGGGCAGAGGG - Exonic
1083773227 11:64879647-64879669 CTGTGTGTGGCCGGGGAGGATGG - Intronic
1084115742 11:67042002-67042024 CTGTGAGCAGAGTGCGAGGAGGG + Intronic
1084144355 11:67256205-67256227 GTGTGTGGAGGGAGGGAGGGAGG + Exonic
1084859518 11:72009186-72009208 CTGTGGGCAGAGAGGGTGGGTGG + Intronic
1087069526 11:94063786-94063808 CTGTGTGGAGCAAAGGAGGTAGG - Intronic
1089656066 11:119947828-119947850 TTGGGTGCAGCCAGGGAGGCTGG + Intergenic
1089806815 11:121097889-121097911 CTGTGTGAAGCCAGGGATGTTGG - Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1091063839 11:132490438-132490460 GTGAGTGCAGCCAGAGAGGATGG - Intronic
1091097491 11:132837860-132837882 CCCTGAGCAGTGAGGGAGGAGGG - Intronic
1091663719 12:2403397-2403419 CTGTGAGGACCCAGGGAGGAGGG + Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092124434 12:6065592-6065614 CAGTGAGCTGTGAGGGAGGAGGG - Intronic
1093253703 12:16839695-16839717 CTGGGTGGAGGGTGGGAGGAGGG + Intergenic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094730850 12:33173300-33173322 GTGGGTGCAGCCAGGGAGGGGGG + Intergenic
1095087689 12:38075462-38075484 TGGGGTGCAGGGAGGGAGGAGGG + Intergenic
1095392054 12:41719289-41719311 GTGTGTGTGGCGGGGGAGGAGGG - Intergenic
1096124169 12:49107503-49107525 CAGTGTGCATGGAGGTAGGAGGG - Intronic
1096883077 12:54688344-54688366 CAGTGTCCAGTGAGGGAGCAAGG + Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1098620635 12:72593663-72593685 CTGTCAGCAGGGTGGGAGGAGGG - Intronic
1100272080 12:93035534-93035556 GTCTGTGCAGAGAGAGAGGATGG + Intergenic
1102396016 12:112586439-112586461 CTGGATGCAGTGAGGGAGTAAGG + Intronic
1102581324 12:113890116-113890138 TTTTGGGCAGCGAGGGAGGGGGG - Intronic
1102677740 12:114669520-114669542 CTGTGTCACGCGAGGGAGGAGGG - Intergenic
1103023023 12:117551729-117551751 CTGTGTGAAGCCAGCGAGAAGGG + Intronic
1103341047 12:120221349-120221371 CTGGGAGCACCCAGGGAGGAAGG + Intronic
1103518764 12:121524142-121524164 CTTTCTGCAGGGAGGGAGGTAGG - Intronic
1104068659 12:125326658-125326680 CTGTCTGCACCGGGGGAGGTCGG + Exonic
1104300362 12:127559438-127559460 CTGTGTGGGGAGTGGGAGGAGGG + Intergenic
1104657951 12:130587958-130587980 CTGTGTGGAGGGACAGAGGAAGG - Intronic
1104728899 12:131094403-131094425 CTGTGGGCACCGGGGCAGGACGG + Intronic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1106253398 13:28001212-28001234 CTGTGTGCAGCCAGGCACGCTGG + Intergenic
1106321359 13:28642473-28642495 GTAAGTGCAGAGAGGGAGGAAGG - Intergenic
1106652159 13:31703348-31703370 CTGTGAGCGGCGGGGGAGGTGGG + Intergenic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1113233956 13:108248403-108248425 CTCTGTGGAGGGAGGGAGGGAGG + Intergenic
1113576080 13:111396214-111396236 CAGCATGCACCGAGGGAGGAGGG + Intergenic
1113743443 13:112726282-112726304 CTGTGTGCAGGGAGAGGGGCTGG + Intronic
1113850813 13:113416929-113416951 GTGTGTGCAGTGAGAGATGAGGG + Intergenic
1113881252 13:113627915-113627937 CACTGTGCAGCCAGTGAGGAGGG + Intronic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116034857 14:39615543-39615565 CTGTGTGCCCTGAGAGAGGATGG + Intergenic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118744905 14:68766748-68766770 CTGTGTGCAGCCTTGGAGCAGGG - Intergenic
1118807472 14:69250574-69250596 CTGTGTGCAGCTGGGGAGGCAGG + Intergenic
1118811963 14:69281723-69281745 CTGTGTGCTGGGATGGAGAAAGG - Intronic
1119895970 14:78220336-78220358 AGGTGTGCAGAGAGGGAGGAGGG + Intergenic
1121302291 14:92881334-92881356 CTCTGTGCAAAGAGGGAGGTGGG - Intergenic
1121567759 14:94923508-94923530 CTGTGGGCAGTGAAGGTGGAGGG - Intergenic
1121894508 14:97634014-97634036 ATTTGTGGAGGGAGGGAGGAAGG + Intergenic
1121964983 14:98295688-98295710 TTTTGTGCAGCTAGGGATGAGGG - Intergenic
1122573873 14:102728390-102728412 CTGTGTACACCGAGGGCGGCAGG + Exonic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1123793987 15:23753384-23753406 CAGTGTGCAGAGCAGGAGGAGGG + Intergenic
1125601053 15:40915975-40915997 CAGTGTGCAGCCAGGGTTGAGGG - Intergenic
1128455018 15:67827329-67827351 CTCTGAGCAGCGGGGTAGGACGG - Intronic
1128762639 15:70227925-70227947 CAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1129364701 15:75047177-75047199 CTGTGTGCAGGGCAGGAGCAAGG - Intronic
1129386967 15:75201764-75201786 CTGTGGGCAGCGGGTGCGGAGGG - Intronic
1129762026 15:78134748-78134770 GTGTTTGCTGGGAGGGAGGATGG + Intronic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1130904404 15:88229672-88229694 CTGTGTGCAGAGAGTGACCAGGG - Intronic
1132196358 15:99917241-99917263 CTGTCTGCTCCCAGGGAGGAGGG - Intergenic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1132386126 15:101401239-101401261 GCGTGGGCAGCGATGGAGGATGG + Intronic
1132943081 16:2518116-2518138 CTGTGGGCAGAGAGGGGGCAGGG + Intronic
1135181842 16:20281592-20281614 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1135479112 16:22806445-22806467 GTGTGTGGAGCGAGGAAGGTGGG + Intergenic
1135505224 16:23030574-23030596 CTGTGTGAAGCCAGGATGGATGG + Intergenic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1137351730 16:47719212-47719234 CCATGTGGAGTGAGGGAGGAAGG - Intergenic
1137494286 16:48957784-48957806 CTGTGTGCTGGGAGGTGGGATGG - Intergenic
1138344462 16:56311622-56311644 ATGTCAGCAGGGAGGGAGGAGGG - Intronic
1138907413 16:61353949-61353971 CTGTGTTAAGTGAGGCAGGAAGG - Intergenic
1139544881 16:67645425-67645447 CTGCGGCCAGCGAGGAAGGAGGG - Intronic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1140298179 16:73728995-73729017 GTGTGTTCAGCCAGGGAAGAAGG + Intergenic
1140416160 16:74774992-74775014 GTGTGTCCCGCGCGGGAGGAGGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1141867834 16:86762885-86762907 TTTTGTGCAGACAGGGAGGAAGG + Intergenic
1141995416 16:87634086-87634108 GTGGGTGCAGAGAGGCAGGAGGG + Intronic
1142024922 16:87807259-87807281 CTGGAAGCAGGGAGGGAGGAGGG + Intergenic
1142132057 16:88435658-88435680 CTGTGTCCAGGGAGGATGGATGG + Exonic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1144831120 17:18131712-18131734 CTGTGTGCTGCGGGGCAGGGAGG - Intronic
1147308505 17:39579774-39579796 CTGCATGCGGCGGGGGAGGAGGG - Intergenic
1147554004 17:41464759-41464781 CTGTGTTCATCCTGGGAGGAGGG + Intronic
1148000097 17:44382829-44382851 GAGTGTCCAGAGAGGGAGGAGGG - Intronic
1148239052 17:45988082-45988104 CCGTGTGCAGCGAGGGAAGGAGG + Intronic
1148444093 17:47727269-47727291 CTGTCTGCTGAGAGGCAGGAAGG + Intergenic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG + Intronic
1151882928 17:76905675-76905697 CTGGGTGGAGGGAGGGAGGGAGG - Intronic
1152603599 17:81277842-81277864 CTGTGTGCAGCCGGGGAGAAGGG + Intronic
1154399551 18:14023532-14023554 CTGTGTCCAGAGACAGAGGAGGG + Intergenic
1154493111 18:14936400-14936422 GTTTGTGGAGGGAGGGAGGAAGG - Intergenic
1156713662 18:39979182-39979204 CTGTCTGCAGCGTGGAAGTATGG + Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157685383 18:49638995-49639017 CTGGGTGCAGCTGGGGAGCAGGG - Intergenic
1158315972 18:56211443-56211465 GTGTGTGTAGGGAGGAAGGAAGG - Intergenic
1158806824 18:60983650-60983672 CTGTGTGCAACAAGGAAGCATGG + Intergenic
1158932399 18:62334465-62334487 CTCTGTGTAGGGTGGGAGGAGGG + Intronic
1159678364 18:71314860-71314882 CAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1159942496 18:74419053-74419075 TTGGGAGCAGCGAGGCAGGAGGG - Intergenic
1159994998 18:74955829-74955851 GTGTGTGCAGGGAGAGAGGATGG - Intronic
1160025875 18:75215796-75215818 GTGTGTGCAGGGTGGTAGGAGGG - Intronic
1160246250 18:77162546-77162568 CTCTCAGCAGCCAGGGAGGAAGG - Intergenic
1160419031 18:78731687-78731709 TTGTGTGCAGCTGGGGTGGAGGG - Intergenic
1160583382 18:79900132-79900154 CTGCCTCCAGCCAGGGAGGAGGG + Intronic
1161325598 19:3662194-3662216 CTGTGTGGCCCGAGGGAGGGTGG - Intronic
1161474553 19:4477018-4477040 CTGAGTGGAGCAAGGCAGGAGGG + Intronic
1161480553 19:4508210-4508232 CTGTGTGCAGAGGGGGATGTGGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1163309236 19:16503143-16503165 CTGTCTGCTGCCAGGGAGGTTGG - Exonic
1163383657 19:16985742-16985764 ATGGGTGGAGGGAGGGAGGAAGG + Intronic
1163737173 19:18988518-18988540 CTGTGTGGAGGGAGGCAGCAAGG + Intergenic
1163822269 19:19502730-19502752 CTGGGTGCAGAGAGTGAGGGTGG - Intronic
1164451248 19:28367080-28367102 CTGTGAGCAGCATGGGTGGATGG + Intergenic
1164670019 19:30067141-30067163 CTGTGTGAAGCAAAGGGGGATGG + Intergenic
1164707314 19:30329675-30329697 CTGGGTGCAGAGAGGGAGAGGGG - Intronic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1166366422 19:42280673-42280695 CTTTGTGCAGGGAGGGCGGACGG - Intronic
1168148892 19:54434517-54434539 TGGTGTGCAACGAGGTAGGAGGG - Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925609649 2:5692556-5692578 CTGTGTGCAGCCTGGAAGGGGGG + Intergenic
926217635 2:10915183-10915205 CTCTGTGCTGGGAGGGAGGTGGG + Intergenic
926587149 2:14699366-14699388 CTGAGTGCATGGAGGAAGGAGGG - Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928255469 2:29718550-29718572 CTGAGTGCAGGGAGGAGGGAAGG + Intronic
928856508 2:35808916-35808938 CTGTGTGCAAAGAGGAAGCAGGG - Intergenic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
930544863 2:52753810-52753832 CTGGGTGCAGGGACAGAGGATGG + Intergenic
930694201 2:54394696-54394718 ATGTGTGGAGGGAGGGAGGGAGG - Intergenic
930851512 2:55965940-55965962 GTGTGTGAAGGGAAGGAGGAAGG + Intergenic
931249923 2:60521311-60521333 CTGTGTGAAGCGAGAGAGAGCGG + Intronic
932425494 2:71631833-71631855 CAGTGTGCAGCGAGGGAGGAGGG - Intronic
932457797 2:71860700-71860722 GTGTGTGCAGTGAGACAGGAGGG + Intergenic
932462740 2:71893843-71893865 CTGTGTTCCGCCAGGGAGGGAGG + Intergenic
933758910 2:85661318-85661340 CTGTGCGGTGAGAGGGAGGATGG + Intronic
934559159 2:95303405-95303427 CTGTGTTCAGGGGGAGAGGAAGG + Intronic
935763642 2:106343609-106343631 CTGTGTGCTCCCAGGGAGGCTGG - Intergenic
936779386 2:116013920-116013942 CTGTGTGCTTCCAGGGATGATGG + Intergenic
937128047 2:119486863-119486885 CTGTGGGCAGCCGTGGAGGATGG + Intronic
937922251 2:127138615-127138637 CTGGGTGGAACCAGGGAGGAGGG - Intergenic
938654086 2:133412941-133412963 CCTTCTGCAGGGAGGGAGGAAGG + Intronic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
941832810 2:169980804-169980826 CTCTTTTCAGCAAGGGAGGAGGG - Intronic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
943387146 2:187216071-187216093 TTGTGGGCAGAGTGGGAGGAGGG + Intergenic
945039281 2:205730611-205730633 CGGTGTGCAGGGAAGGAAGAGGG + Intronic
946059061 2:216926210-216926232 CAGTGTGCAGAGTTGGAGGAAGG + Intergenic
946486474 2:220105323-220105345 CTGGGTGGAGAGAGGAAGGAGGG + Intergenic
947065426 2:226219085-226219107 CTTTGTGAAGGGAGAGAGGAAGG - Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947839192 2:233196845-233196867 CTGTGTACAGCGGGGGTGGCTGG - Intronic
947869812 2:233428311-233428333 CTGTGGGCAGCTAAGAAGGATGG + Intronic
948389403 2:237601261-237601283 CTCTGTGCAGGGTGAGAGGATGG - Intronic
948456777 2:238108185-238108207 CTGCGCGAAGGGAGGGAGGATGG - Intronic
948711212 2:239826912-239826934 CTGAGTGCACGGAGAGAGGAAGG - Intergenic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1170705272 20:18738739-18738761 CTGCCAGCAGGGAGGGAGGAAGG + Intronic
1170937881 20:20825408-20825430 CTGTGAGCTGCGAGGGAGGCCGG + Intergenic
1171381539 20:24737694-24737716 CTGTGTCCAGGGAGTGATGAGGG - Intergenic
1171993217 20:31712776-31712798 GTGTGTGTGGCCAGGGAGGAGGG + Intronic
1172042046 20:32052587-32052609 CTGGGGGCAGCGAGGGGAGACGG + Intronic
1172592751 20:36128957-36128979 GTGGGTGGAGAGAGGGAGGAAGG + Intronic
1172687787 20:36770021-36770043 TGGGGTGCAGGGAGGGAGGAGGG + Intronic
1172786025 20:37469484-37469506 CTCTGGGAAGCAAGGGAGGAGGG - Intergenic
1173279671 20:41617815-41617837 CTGTTTGCAGGGGTGGAGGAGGG - Intronic
1173749563 20:45466793-45466815 CTAGTTGCAGAGAGGGAGGATGG + Intergenic
1174836927 20:53865061-53865083 CTGTGTACAGAGAGGGCCGATGG + Intergenic
1174937057 20:54882308-54882330 TTGGGTGCGGGGAGGGAGGAGGG - Intergenic
1175265026 20:57697332-57697354 CTGAGTGCAGCAAGGATGGAGGG + Intronic
1175369998 20:58481764-58481786 CTGGGTGGAACGAGGGAGGCTGG - Intronic
1175548859 20:59802606-59802628 CTGTGTGCAGGGAGCGTGGAAGG + Intronic
1175661676 20:60818473-60818495 CAGTGTGCTGCAAGGGAGAAAGG + Intergenic
1175976096 20:62711173-62711195 CTATGTGCAGCCAGGGAGACTGG - Intronic
1175984203 20:62755849-62755871 ATGGGTGGAGGGAGGGAGGATGG - Intronic
1176861731 21:14014791-14014813 CTGTGGGCAGCGGGGGCGGGGGG - Intergenic
1177686533 21:24444172-24444194 GTGTGTGTGGCGGGGGAGGAGGG + Intergenic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180934418 22:19615335-19615357 CTCTGTGTACCGAGGGAGGTGGG + Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181235963 22:21447858-21447880 CCTTGTTCAGCGAGGAAGGAGGG - Exonic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1183665738 22:39244774-39244796 CTCTTTGCAGCGAGGCTGGAGGG + Intergenic
1183730905 22:39617837-39617859 CAGAGAGCAGGGAGGGAGGAGGG - Intronic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184564939 22:45286142-45286164 CTGTCTGCAGGGAGGAGGGAAGG + Intronic
1184602550 22:45552178-45552200 GTGTGTGCTAGGAGGGAGGAGGG + Intronic
1184659843 22:45960694-45960716 CTGTGATCAGCCAGGGAGGCGGG + Intronic
1184835652 22:47019557-47019579 GGGTGTGCAGGGAGGGAGGATGG + Intronic
1184944590 22:47794114-47794136 AGGTGTGAAGGGAGGGAGGAAGG - Intergenic
1185051199 22:48555177-48555199 CCGAGTGAAGGGAGGGAGGATGG + Intronic
950151981 3:10694842-10694864 CTGTCAGCAGAGAGGGAGGGGGG - Intronic
950441700 3:13014470-13014492 CTGTCTGCAGCGTGGGGGCAGGG + Intronic
950486989 3:13279759-13279781 CTGTGTGCAGGTAGGGGGAAAGG + Intergenic
952815865 3:37447236-37447258 CTCTCTGCAGTGAGGCAGGAGGG + Intergenic
953345564 3:42172508-42172530 CAGTGTGCAGCAATGGGGGAGGG - Intronic
953391348 3:42535692-42535714 CTGTGTGCAGTGAGTGGGGAGGG + Intronic
953412115 3:42696527-42696549 CTGTCTGCAGCCTGGGAGGATGG - Intronic
954462988 3:50638264-50638286 CCCGGTGCAGGGAGGGAGGATGG + Intronic
954469032 3:50675484-50675506 CTCTGTGCAGAGAGGGCGGCAGG + Intronic
954709411 3:52497894-52497916 GTTTGGGCAGCGAGGCAGGAAGG + Intronic
955231094 3:57099230-57099252 CTGTGTGAAGCCATAGAGGAAGG - Intronic
956661364 3:71601577-71601599 CTGACTGCAATGAGGGAGGAAGG + Intergenic
959182841 3:103004055-103004077 CTTTGGGAAGCGAAGGAGGAAGG - Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
959820164 3:110724614-110724636 CTATGTGCAGCGAGCAAGTAAGG - Intergenic
961566058 3:127763978-127764000 CTGAGAGCCGGGAGGGAGGAGGG - Intronic
962071153 3:132034909-132034931 TGGAGTGGAGCGAGGGAGGAAGG + Exonic
962281142 3:134052778-134052800 CTGTGTGAAGCGGTGGAAGAAGG + Intergenic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
962734996 3:138317816-138317838 CTGTGTACAGCAAGTCAGGAAGG + Intronic
965475227 3:169147833-169147855 GTGTGTGCACCGAGGCAGGAGGG + Intronic
966770600 3:183500350-183500372 GTGTGGCCAGGGAGGGAGGAAGG + Intronic
966912395 3:184566715-184566737 GAGTGTGCAGCGGGGCAGGAGGG - Intronic
967054279 3:185815087-185815109 ATGTATGCAGTGTGGGAGGAGGG - Intronic
968615719 4:1576972-1576994 CAGTGTGCAGTGTGGGAGGGAGG - Intergenic
969643453 4:8412798-8412820 CGCAGGGCAGCGAGGGAGGATGG - Intronic
970740755 4:19234959-19234981 GTGTGTGAAGGGAGGAAGGATGG - Intergenic
971041671 4:22760187-22760209 CTATGTGCAGAGATGGGGGAGGG + Intergenic
972045226 4:34656981-34657003 CTTTGGGCAGCAAGGAAGGAAGG + Intergenic
972452310 4:39214365-39214387 CTGTGTGCAGAGATGGGGGGCGG - Intronic
972817061 4:42656661-42656683 CTGGGGGCAGCGCGGGGGGAAGG + Intronic
972921002 4:43941699-43941721 CAGTCTGCAGAGAGGCAGGAAGG - Intergenic
975229391 4:71913647-71913669 TTGTGTGTAGTGAGTGAGGAGGG + Intergenic
980731256 4:136826675-136826697 CAGAGTGCAGAGAGGTAGGAGGG - Intergenic
981533883 4:145779374-145779396 CTGTGTGCAGCGAGAGGTGTCGG + Exonic
982118499 4:152117174-152117196 CTGAGTGAAGCCAGGGAGCACGG - Intergenic
983551849 4:169025794-169025816 CAGTGAGCAGTGAGGGAGGACGG + Intergenic
985535587 5:464112-464134 CTGCGTGCAGCGTGGGAGGGAGG - Intronic
985535597 5:464164-464186 CTGCGTGCAGTGTGGGAGGGAGG - Intronic
985573740 5:664183-664205 CAGGGTGCAGCTAGTGAGGACGG + Exonic
986831821 5:11588883-11588905 CGTGGTGCAGGGAGGGAGGAGGG - Intronic
988636882 5:32994539-32994561 GTGTGTGTAGAGAGGGAGGTAGG - Intergenic
989203658 5:38790490-38790512 CTGTGTGCCGCACAGGAGGAAGG + Intergenic
989725948 5:44586982-44587004 ATGTGTGCAGGGATGGATGAGGG - Intergenic
992091632 5:73322838-73322860 CAGTGTGCAGTGACTGAGGAAGG + Intergenic
992529508 5:77640997-77641019 CTGTCTGGAGGGAGGGAGAAGGG + Intergenic
997510709 5:134451903-134451925 CTGTGGCCAGCCAGGGAGGATGG + Intergenic
999964911 5:156798840-156798862 CTGTGTGTGGCGTGGGGGGATGG + Intergenic
1001228423 5:169965085-169965107 CTATGTGCAGCAATGGATGATGG - Intronic
1002058967 5:176615200-176615222 GGGGGTGCAGCGAGGGGGGAGGG - Intergenic
1002190738 5:177476173-177476195 CTGTGAGGAGGGAGGGAGGGAGG - Intergenic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003266135 6:4566221-4566243 CTGTGTGCAGTGATGGAGAGTGG + Intergenic
1003443338 6:6163475-6163497 CAGGGTGCGGCGTGGGAGGAGGG - Intronic
1003712908 6:8613628-8613650 CTGTATGCAACCAGGAAGGAGGG - Intergenic
1004294717 6:14400218-14400240 CTGTATCCTGGGAGGGAGGATGG - Intergenic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1005164796 6:22907375-22907397 GTGTGTGTAGGGAGTGAGGATGG - Intergenic
1007235984 6:40391896-40391918 CTGTGCGCAGGGTGGGAGAAGGG - Exonic
1007285535 6:40744758-40744780 CTGTGTGCAGACAAGGAGGCTGG - Intergenic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1009784576 6:68318242-68318264 AAGTGTGCAGTGTGGGAGGAAGG - Intergenic
1010972268 6:82275561-82275583 CTCTGTCCAGAGTGGGAGGAGGG - Intergenic
1011074242 6:83421008-83421030 CTGTATGCAGACAGGGAGGGGGG + Intronic
1012276849 6:97284468-97284490 GTGTGTGCAGAGAGAGAGGAGGG - Intergenic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1014206609 6:118662802-118662824 CTCTGTAGAGGGAGGGAGGAAGG + Intronic
1015891759 6:137976785-137976807 GTGTGTGTAGGGAGGCAGGATGG - Intergenic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1019219864 6:170464744-170464766 TTGTGAGCAGAGTGGGAGGAAGG - Intergenic
1019289803 7:244943-244965 CTGAGAACAGCGTGGGAGGACGG + Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019786231 7:2979376-2979398 CTGTGTGCAGGGAGCTATGAAGG + Intronic
1019815380 7:3196119-3196141 CTGAGTGCTGGAAGGGAGGATGG - Intergenic
1021431280 7:20560821-20560843 CTGTCTGCAGCTGGGGAGGTGGG - Intergenic
1022509463 7:30925938-30925960 GTGAGTGGAGGGAGGGAGGAAGG - Intergenic
1023158500 7:37275275-37275297 CTGGGTGCTGGGTGGGAGGAGGG + Intronic
1023741879 7:43288309-43288331 CCGGGAGCAGGGAGGGAGGAAGG + Intronic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1026471087 7:70694515-70694537 ATGTGCGGAGGGAGGGAGGAGGG - Intronic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1026955235 7:74372634-74372656 CAGGGGCCAGCGAGGGAGGATGG + Intronic
1027052401 7:75028539-75028561 CTGAGTGCAGCAAGGGGAGAGGG - Intronic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1029686992 7:102155851-102155873 CTGGGTGCAGGGAGTGGGGAAGG - Intronic
1032062920 7:128739599-128739621 CTGTGTGCAGCCTGGGATGGAGG + Intronic
1032675868 7:134129269-134129291 CAGAGTGGAGGGAGGGAGGAAGG - Intronic
1034450249 7:151133427-151133449 CCGAGTGCAGGGAGGGAGGGTGG - Intronic
1034979381 7:155466598-155466620 CTGGGTGCAGCGGAGAAGGAGGG - Intergenic
1035273793 7:157735459-157735481 CTGTGTGCAGCGGCCCAGGAAGG + Intronic
1035939306 8:3878106-3878128 ATGTGGGCAGGGAAGGAGGAAGG - Intronic
1036761642 8:11513588-11513610 CTCTGTGCAGCGAGGGCTGTGGG - Intronic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1038158080 8:25009668-25009690 CTGTGAGCAGAGAGGGAGATGGG - Intergenic
1040109145 8:43558563-43558585 ATGAGTGGAGCCAGGGAGGAGGG + Intergenic
1040279291 8:46030057-46030079 AAGTGAGCAGCGAGGGAGGGAGG + Intergenic
1040547043 8:48406855-48406877 CTGAGGTCAGCGAGGGAAGATGG + Intergenic
1040912533 8:52534744-52534766 GTGTGTGCAGAGGGGCAGGAAGG + Intronic
1040913585 8:52545500-52545522 GTGTGTGCAGGGAGGGAGGTGGG - Intronic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041437437 8:57858128-57858150 CTGGGAGCAGGGAGGGAGGCAGG + Intergenic
1042873501 8:73419353-73419375 CTGTGAGCAGGTAGAGAGGATGG + Intergenic
1043362410 8:79490271-79490293 CTGTGGGCAGTGGGGGAGAAAGG + Intergenic
1043567200 8:81561624-81561646 CTGTGTGCATGGGGGAAGGAGGG + Intergenic
1043960850 8:86416934-86416956 CCTTGGGCAGCAAGGGAGGAAGG - Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044820671 8:96153849-96153871 CCGTGTGCAGTCTGGGAGGAAGG + Intronic
1045535925 8:103027835-103027857 GTGTGTGCAGGGAGGGTGGGAGG - Intronic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048855745 8:138685293-138685315 CAGGGTGCAGCGGGGGAAGAAGG - Exonic
1049851859 8:144836848-144836870 CAGTCTGCAGCGAGGGAGGCAGG + Intronic
1051342179 9:16121523-16121545 CGGTGTGCAGAGAGGGTGGGGGG + Intergenic
1051605887 9:18917534-18917556 CTGTGTGCTTTGAGGGAGAAGGG - Intergenic
1051837908 9:21361781-21361803 CAGAGTACAGCGAGGGATGAGGG - Intergenic
1052067033 9:24034660-24034682 CTATGTCCAGGGAGGGAGGAAGG + Intergenic
1052443007 9:28521970-28521992 CTGTATCCATCGAGGGAGCATGG + Intronic
1053165522 9:35841383-35841405 CTCTGTGCTGGGAGGGAGGGAGG - Intronic
1053291474 9:36882312-36882334 CTGAGTGGAGCGAGGGTGGCTGG - Intronic
1054454695 9:65423843-65423865 CTGTGTCCAGCGAGGTCAGATGG + Intergenic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1056809063 9:89750254-89750276 CTGTGTCAAGCGAGGGGGGGGGG + Intergenic
1056911718 9:90707049-90707071 CAGTGTGCAGTGCAGGAGGAAGG + Intergenic
1057280846 9:93710417-93710439 CAGTGTGCAGCGAGTGGGGGAGG + Intergenic
1057310096 9:93937354-93937376 AAGTGTGCAGGGAGGGAGGGTGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1060019319 9:120115651-120115673 ATGTGTGCTGCTGGGGAGGATGG - Intergenic
1060424512 9:123493293-123493315 CTGTGGGCAACCAGGGAGGTTGG + Intronic
1061541096 9:131278100-131278122 CTGTGTGCGGGGAGCGAGGGTGG - Intergenic
1061736682 9:132665550-132665572 CTCTGAGCAGAGAGGGAGCAAGG + Intronic
1061806544 9:133140425-133140447 CTTTGTGTTCCGAGGGAGGAAGG - Intronic
1062120429 9:134831151-134831173 CTGTGTCCACCCAGGGAGGCTGG - Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062222446 9:135424557-135424579 ATGTGTGCAGGGGGGGCGGAGGG + Intergenic
1185859570 X:3565006-3565028 GTGAGTGCAGCGAGGGATGAAGG + Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1187588824 X:20693363-20693385 CTGTGGGCTGCAAGGGAGCAGGG + Intergenic
1187814068 X:23211852-23211874 GTGGGTGCAGTGAGGGAGAAGGG - Intergenic
1189171647 X:38915221-38915243 CTGTGAGCTGAGAGTGAGGAGGG + Intergenic
1190491886 X:50990624-50990646 CTGAGGGCAGAGAGGGAGGCAGG - Intergenic
1190501276 X:51081056-51081078 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1192724027 X:73728908-73728930 CTCTGTGCAGCTGGGCAGGAAGG + Intergenic
1193570442 X:83134963-83134985 GAGTGTGGAGGGAGGGAGGAGGG + Intergenic
1195614144 X:106899722-106899744 CTGTGTGCATGTGGGGAGGAGGG - Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196401636 X:115323234-115323256 TAGTGTGCAGGGTGGGAGGAGGG + Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198507073 X:137311541-137311563 GAGTGTGCAGAGTGGGAGGAGGG - Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic