ID: 1072806409

View in Genome Browser
Species Human (GRCh38)
Location 10:98426236-98426258
Sequence GGGGCTGGGTGGTGGCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072806400_1072806409 4 Left 1072806400 10:98426209-98426231 CCAAGCAGGGCAGTGGGCAGGGG 0: 1
1: 0
2: 9
3: 96
4: 625
Right 1072806409 10:98426236-98426258 GGGGCTGGGTGGTGGCACAGAGG No data
1072806395_1072806409 11 Left 1072806395 10:98426202-98426224 CCGGGTGCCAAGCAGGGCAGTGG 0: 1
1: 0
2: 0
3: 39
4: 363
Right 1072806409 10:98426236-98426258 GGGGCTGGGTGGTGGCACAGAGG No data
1072806394_1072806409 12 Left 1072806394 10:98426201-98426223 CCCGGGTGCCAAGCAGGGCAGTG 0: 1
1: 0
2: 2
3: 38
4: 371
Right 1072806409 10:98426236-98426258 GGGGCTGGGTGGTGGCACAGAGG No data
1072806391_1072806409 23 Left 1072806391 10:98426190-98426212 CCAGAGTCTGGCCCGGGTGCCAA 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1072806409 10:98426236-98426258 GGGGCTGGGTGGTGGCACAGAGG No data
1072806390_1072806409 24 Left 1072806390 10:98426189-98426211 CCCAGAGTCTGGCCCGGGTGCCA 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1072806409 10:98426236-98426258 GGGGCTGGGTGGTGGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072806409 Original CRISPR GGGGCTGGGTGGTGGCACAG AGG Intronic
No off target data available for this crispr