ID: 1072806705

View in Genome Browser
Species Human (GRCh38)
Location 10:98428082-98428104
Sequence CTGTTGAGAAGCAGAGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072806705_1072806709 2 Left 1072806705 10:98428082-98428104 CCCAGAACTCTGCTTCTCAACAG 0: 1
1: 0
2: 2
3: 23
4: 217
Right 1072806709 10:98428107-98428129 CTCAGGCTCATCAAGAGCTCAGG No data
1072806705_1072806711 21 Left 1072806705 10:98428082-98428104 CCCAGAACTCTGCTTCTCAACAG 0: 1
1: 0
2: 2
3: 23
4: 217
Right 1072806711 10:98428126-98428148 CAGGGAATCTGAAGATAGCTAGG No data
1072806705_1072806710 3 Left 1072806705 10:98428082-98428104 CCCAGAACTCTGCTTCTCAACAG 0: 1
1: 0
2: 2
3: 23
4: 217
Right 1072806710 10:98428108-98428130 TCAGGCTCATCAAGAGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072806705 Original CRISPR CTGTTGAGAAGCAGAGTTCT GGG (reversed) Intronic
900801171 1:4737978-4738000 CTCTTGTGAAACTGAGTTCTGGG - Intronic
903658633 1:24963838-24963860 CTGCAGGGATGCAGAGTTCTGGG - Intronic
903771151 1:25765284-25765306 CTGTTGAGAAGCCCAGCTCTGGG + Intronic
904527647 1:31146115-31146137 CTCTTGAGGAGCAGAGGACTTGG + Intergenic
905305275 1:37013610-37013632 CGGCTAAGAAGCAGAGCTCTCGG - Intronic
905589916 1:39154333-39154355 CTGGTGAGACTCTGAGTTCTGGG + Intronic
906792267 1:48669356-48669378 ATGTTGAGCTGCAGAGCTCTTGG + Intronic
907809176 1:57851529-57851551 CTGCTGAGCAGAAGAGTACTGGG + Intronic
908164394 1:61443736-61443758 AAGTTGAGAAGGAGAGTCCTTGG + Intronic
910008882 1:82435941-82435963 AAGTTGAGAAGCAGAGTGATAGG - Intergenic
910149011 1:84118731-84118753 CTGTTTCCAAGCAGAGTCCTAGG - Intronic
912119971 1:106459004-106459026 CTGCACAGAAGCAGAGTTCTCGG + Intergenic
913310763 1:117489970-117489992 CAGTTTTGAAGCAGAGTTCAAGG + Intronic
915920626 1:159973093-159973115 CTCCTGGGATGCAGAGTTCTGGG + Intergenic
919641014 1:200043250-200043272 CTGCTGAGAAGCGGGTTTCTGGG + Intronic
920578145 1:207078429-207078451 CATTTGAGAAGCACTGTTCTAGG + Intronic
922024451 1:221737733-221737755 CTTTTGTTAAGCAGTGTTCTGGG - Intronic
922027091 1:221760269-221760291 CTAGTGGGAAGCAGAGTGCTGGG - Intergenic
922636351 1:227176339-227176361 ATGTTAAGAATCAGAATTCTTGG - Intronic
923435471 1:233963946-233963968 CTATGGAGAAGCTGAGATCTGGG - Intronic
923526387 1:234776015-234776037 CTGATAAGAATCAGATTTCTAGG - Intergenic
924017974 1:239748549-239748571 CTGTGCAGAAGCTGATTTCTAGG + Intronic
1062981487 10:1726608-1726630 CTGTTGAGAGTCAGAGTCCTCGG + Intronic
1063371215 10:5524164-5524186 CTGCTGAGAAGCAGCTGTCTAGG - Exonic
1064000517 10:11660301-11660323 GTGTTCAGAAGCACAGATCTGGG - Intergenic
1064313044 10:14228835-14228857 CTGTTCAAAAGCAGAATTCTAGG + Intronic
1064887415 10:20125185-20125207 CACTTGAGAAGCAGAGTATTAGG + Intronic
1065135119 10:22659967-22659989 GTCTTGCGAAGCAGAGCTCTGGG + Intronic
1067237776 10:44466159-44466181 CAGCTGAGAAGCAGAGTTTAAGG - Intergenic
1068929920 10:62579027-62579049 CAGTTGTGGAGCAGTGTTCTTGG - Intronic
1069657235 10:70099014-70099036 ATGTTGAGAAGCAGAGGACTAGG - Intronic
1071503122 10:86217553-86217575 CTGTTGAGCAGAAAAGCTCTTGG + Intronic
1072806705 10:98428082-98428104 CTGTTGAGAAGCAGAGTTCTGGG - Intronic
1073150743 10:101309890-101309912 CTGTTGAGCAGCCTAGTACTGGG - Intergenic
1074876951 10:117621297-117621319 CTCTGGAGAAGCAGAGCTCTGGG - Intergenic
1078898262 11:15617249-15617271 CTGATCAGAAACAGACTTCTAGG + Intergenic
1080133983 11:28832007-28832029 CTGATGAGTAGCAAAGTTCAAGG - Intergenic
1080282014 11:30568303-30568325 CTGTTGCTAAGCAGAAATCTGGG - Intronic
1083086771 11:60156142-60156164 CTTTTGAGAAGCTGAAATCTAGG + Intergenic
1083553443 11:63607840-63607862 TTGGTCAGAAGCAGGGTTCTTGG + Intronic
1083679645 11:64345184-64345206 GGGTTGGGAAGCAGAGTTCCAGG + Intronic
1085957383 11:81415634-81415656 CTTTTGAGAAGCACAGATCTAGG + Intergenic
1086893639 11:92287557-92287579 CTGTCAAGAAGTAGAGTTGTAGG + Intergenic
1087856344 11:103096140-103096162 ATGATGACAAGCAGTGTTCTAGG - Intergenic
1089131903 11:116218944-116218966 CTGTTGTGAAGTACAGTCCTTGG - Intergenic
1093987258 12:25549631-25549653 CCTTTGAAAAGCAGAATTCTGGG - Intronic
1095480887 12:42634393-42634415 CTTTTCACTAGCAGAGTTCTTGG - Intergenic
1095498893 12:42815035-42815057 CTGTTTAAAAGCAGAGTTCCTGG + Intergenic
1096873190 12:54607628-54607650 CTGTGGTGAAGCAGAAGTCTTGG + Intergenic
1098332561 12:69369135-69369157 CTGTTAAAAAGCAGTTTTCTTGG - Intronic
1098474855 12:70888777-70888799 CTGTGGAGAAGCAGATGTCTAGG - Intronic
1101222270 12:102654020-102654042 CTTTTGAGAAGCAAAGATTTGGG + Intergenic
1101268758 12:103120175-103120197 CTGTTGAGAAGTTGAGTTCAAGG + Intergenic
1102534726 12:113572742-113572764 AGGTTGAGGGGCAGAGTTCTAGG + Intergenic
1102650409 12:114438272-114438294 CTGTTGAGAAGGGGAGACCTGGG + Intergenic
1103417290 12:120751513-120751535 CAGGAGAGGAGCAGAGTTCTAGG + Intergenic
1104726722 12:131082257-131082279 CTGTTTAGATGCAGACTTCCTGG + Intronic
1106119836 13:26851080-26851102 CTTTTCAGAAACAGATTTCTGGG + Intergenic
1106421140 13:29587396-29587418 CTTTTGAGAAGCACAGTCATTGG + Intronic
1107672933 13:42765158-42765180 TAGTTAAGGAGCAGAGTTCTAGG + Intergenic
1110682505 13:78333037-78333059 CAGTGGTGAGGCAGAGTTCTTGG - Intergenic
1112756910 13:102645879-102645901 CTGGTGAGCAGCAGGGGTCTGGG + Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115260080 14:31443003-31443025 CTGTTAAGATGCAGTTTTCTGGG - Intronic
1116115087 14:40637764-40637786 GGGTTCAGAAGCAGACTTCTGGG + Intergenic
1117731475 14:58726854-58726876 TTGTTCAGAGGCAGAGGTCTCGG + Intergenic
1117903684 14:60562254-60562276 GTGCTGAAAAGCTGAGTTCTTGG - Intergenic
1118185708 14:63536178-63536200 TTCTTGGAAAGCAGAGTTCTTGG + Intronic
1118588099 14:67375810-67375832 CTTTTGAGAAGCACTTTTCTGGG + Intronic
1118770259 14:68938170-68938192 CTGATGAAAAGCAGAGTCTTCGG + Intronic
1119986419 14:79143174-79143196 CTGTTGGGAATCAGGGTGCTGGG - Intronic
1121605891 14:95239482-95239504 CTGTTGAGAACCACAGATTTTGG + Intronic
1121854001 14:97249634-97249656 ATGTTTATAAGCAGAGTTTTTGG + Intergenic
1122055078 14:99091681-99091703 AGTTTGAGAACCAGAGTTCTAGG + Intergenic
1123025747 14:105422919-105422941 CCCTTGAGAAGCAGAGGTCAGGG - Intronic
1127625222 15:60773867-60773889 CTTTTCAAAAACAGAGTTCTTGG - Intronic
1127714442 15:61635447-61635469 CTGTTCAGAGACAGTGTTCTGGG + Intergenic
1127913426 15:63436791-63436813 GTGTTGAGAAACACACTTCTAGG + Intergenic
1128585519 15:68846283-68846305 CTGTTTAGAAGCCAAGATCTGGG - Intronic
1128796710 15:70471663-70471685 CATCTAAGAAGCAGAGTTCTGGG - Intergenic
1129050188 15:72774659-72774681 CTGTTGAAACACAGATTTCTGGG - Intronic
1129253269 15:74320174-74320196 CTGTTCAGAAGCAGAGCTTCCGG + Intronic
1131438335 15:92440332-92440354 CTATTGACATGCAGAGTTTTGGG + Intronic
1132221840 15:100110945-100110967 CTGGTGAGAAGCAGACTTCGTGG - Intronic
1133406760 16:5530757-5530779 CAGTTGAGAAGCACTGCTCTAGG + Intergenic
1133501497 16:6371667-6371689 GTGTTTAGAAACAAAGTTCTGGG + Intronic
1133887835 16:9847156-9847178 TTCTTGAGAAGCATAGATCTGGG + Intronic
1134315889 16:13118501-13118523 CTTTTGGGAAGCACTGTTCTAGG - Intronic
1134567404 16:15263372-15263394 CAGTTGAGAACCAGTGTTGTAGG + Intergenic
1134735088 16:16493328-16493350 CAGTTGAGAACCAGTGTTGTAGG - Intergenic
1134816740 16:17212048-17212070 CAGTTGAGAACCACTGTTCTAGG + Intronic
1135031443 16:19042009-19042031 CTGTGGAGATTCAGAGTTTTTGG + Intronic
1136089046 16:27905218-27905240 CTGTTAAGAAACAGAGTACTGGG - Intronic
1138054784 16:53821215-53821237 GTGTTCAGAAACAGAGTTCTTGG + Intronic
1146211249 17:30945405-30945427 ATGTTGAGAAGCAGGGTCCCGGG - Intronic
1146996788 17:37327788-37327810 ATTTTGAGTAGCAGATTTCTTGG + Intronic
1149635980 17:58169859-58169881 CTGAAGAGAAACAGAGGTCTAGG - Exonic
1150424990 17:65070144-65070166 CTGGTTAGAACCAGAGTCCTGGG + Intergenic
1151926734 17:77203179-77203201 CCGTTGAAAATCAGAGCTCTTGG + Intronic
1152160915 17:78668150-78668172 CTGGTGAGTAGCAGAGTTGATGG - Intergenic
1153326352 18:3824257-3824279 GTGTTCAGAAGCAGAGATGTGGG + Intronic
1153330999 18:3874506-3874528 CTTTTAAAAAGCAGAATTCTTGG - Intronic
1154025367 18:10702715-10702737 CTGGTGCGTAGCAGGGTTCTTGG + Intronic
1155791830 18:29981663-29981685 CTTTTAAGAAGGAGAGTTATGGG + Intergenic
1157299063 18:46466675-46466697 CTGTTGGGATACAGAGCTCTAGG + Intergenic
1157794645 18:50562093-50562115 CTGCTCAAAAGCAGAATTCTAGG - Intronic
1158368903 18:56774261-56774283 CTGTTGAGAAGCAGAATCTAGGG + Intronic
1158419395 18:57279524-57279546 CAGGTGAGAAGGAGTGTTCTGGG + Intergenic
1160410155 18:78670303-78670325 CTGTGGAGAAGCTGCGTTCCTGG - Intergenic
1161361611 19:3853111-3853133 CTGTTGAGAAACTCAGATCTGGG + Intronic
1162424027 19:10583297-10583319 CTGATGAGATGCAGAGTGATGGG + Intronic
1166608496 19:44166851-44166873 TTGTTGAAATGCAGATTTCTGGG - Exonic
1168054480 19:53854397-53854419 TTGCTGGGAAGCAAAGTTCTGGG - Intergenic
925744534 2:7033079-7033101 CTGTAGAGAAGGTGAGTTCCAGG + Intronic
926228383 2:10984340-10984362 CAGGTGAGAAGGAGTGTTCTGGG - Intergenic
926501926 2:13666401-13666423 TTATTGAGAAGCAGACTTCGTGG + Intergenic
926704203 2:15825362-15825384 CTGGTGGGAAGGAGATTTCTCGG + Intergenic
927784599 2:25964969-25964991 AGATTGTGAAGCAGAGTTCTAGG - Intronic
928552513 2:32386812-32386834 TTGTAGAGAAGGAAAGTTCTAGG + Intronic
928615191 2:33031371-33031393 CTATTGAGAATCTGTGTTCTGGG - Intronic
928653878 2:33429063-33429085 TTGTTGTGAAGCAGATATCTGGG - Intergenic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
932282527 2:70506448-70506470 CTGTTGAAATGCAGATTCCTAGG - Intronic
936851541 2:116905049-116905071 CTGAAAAGAAGCAGAGATCTAGG - Intergenic
937163222 2:119786099-119786121 CTGTTGAGTAGCACTGTCCTAGG - Intronic
940372711 2:152920755-152920777 AGGTTGAGAAGGAGAGCTCTGGG + Intergenic
940600054 2:155847507-155847529 CTGTTGATAATCAAAATTCTTGG - Intergenic
942272062 2:174286382-174286404 CTGGTGAGCAGCTGAATTCTAGG + Intergenic
942512301 2:176715420-176715442 CTGGTTAGAATCAGAGTTCCTGG + Intergenic
943636944 2:190317426-190317448 TTGCTGGGAAGCACAGTTCTAGG - Intronic
943982264 2:194569227-194569249 CTGTTGCGTAGCAGAATTCTTGG + Intergenic
945705737 2:213229040-213229062 CTTCTGTGAAGCAGAGTTATGGG + Intergenic
945727189 2:213485798-213485820 CTGTTGAGTGGCACAGATCTAGG + Intronic
946152291 2:217784857-217784879 TGGTTGAGAAGCACTGTTCTGGG + Intergenic
946374980 2:219302492-219302514 CTGTGGAAAACCAGAGATCTGGG + Intronic
1169033085 20:2428261-2428283 CTATTGAGAACCATTGTTCTAGG + Intronic
1169332731 20:4729563-4729585 CTGTTGAGGAACAGACTTCTTGG + Intergenic
1169905455 20:10598750-10598772 CTGGTAAGAAGCCGATTTCTTGG + Exonic
1170493235 20:16899556-16899578 CTATTGAGAAACAGGATTCTAGG + Intergenic
1171385314 20:24765862-24765884 CTGTTGACAAGCAGAGAAGTAGG + Intergenic
1173172396 20:40737993-40738015 CTGTTGAGAATCATTGATCTAGG - Intergenic
1174988084 20:55478428-55478450 CTGTTAAAAAGGACAGTTCTGGG - Intergenic
1178829371 21:36042691-36042713 CTGTAGAGAAGCAGTTTTCTAGG - Intronic
1179151080 21:38808625-38808647 GTGTTGGGTAGCAGGGTTCTTGG + Intronic
1179777585 21:43676422-43676444 CTGCTGTGAAGCAGTGTCCTGGG - Intronic
1180936143 22:19626417-19626439 CTGATGGGAGGCAGAGTTCAGGG - Intergenic
1181411134 22:22720629-22720651 GGGCTCAGAAGCAGAGTTCTGGG + Intergenic
1182141972 22:27967344-27967366 GTTTTTAGAAGCCGAGTTCTGGG + Intergenic
1184963378 22:47948202-47948224 CTATTGAGCAGAAAAGTTCTGGG - Intergenic
950951625 3:17006174-17006196 CTGGTCAGAAGCAGAGAGCTGGG - Intronic
954808781 3:53235417-53235439 TTGTTAAGAAACAGAGGTCTAGG + Intronic
955218900 3:57007652-57007674 CTCATGAGCAGCAGAGTTCCCGG - Intronic
956365035 3:68491884-68491906 TTGTTAAGATGCAGATTTCTGGG - Intronic
957311333 3:78523194-78523216 TTGTTGTGAAACAGAGCTCTAGG - Intergenic
958757076 3:98261753-98261775 AATTTGAGAAGCAAAGTTCTAGG + Intergenic
959244416 3:103846257-103846279 TTGTTGAGAAGTAGAGTTCTGGG + Intergenic
959641720 3:108645549-108645571 CTTTTGGAAAGCAGAGTTCAAGG + Intronic
961007975 3:123417462-123417484 CTGTTCAGTTACAGAGTTCTGGG - Intronic
962216846 3:133529997-133530019 TTGTTAAGATGCAGAGTTCTGGG - Intergenic
963168589 3:142229114-142229136 CTGTTGAGTAGGAGAGGCCTGGG + Intergenic
963257545 3:143160679-143160701 CAGCTGAGAAGCAGAGCCCTTGG - Intergenic
963383552 3:144561205-144561227 CTGCTTGGAAACAGAGTTCTTGG - Intergenic
965177916 3:165360035-165360057 TTGTTGAGAAGCACAGATATTGG - Intergenic
966174602 3:177122632-177122654 GTGAGGAAAAGCAGAGTTCTTGG + Intronic
966749001 3:183304373-183304395 CTGTTTAGAACAAGTGTTCTGGG - Intronic
967423952 3:189304775-189304797 TTGTTGAAAGGCAGACTTCTAGG - Intronic
968863694 4:3193821-3193843 CTGTTGAGAAGCAGCTTTACTGG + Intronic
970154045 4:13123347-13123369 CTGTTGAGGAGCAGTGATCCTGG + Intergenic
975063536 4:70035217-70035239 CTGTTAAGAGACAGAGTTCTGGG + Intronic
975065475 4:70057564-70057586 GTGTTAAGATGCTGAGTTCTGGG + Intronic
975827083 4:78331324-78331346 CAGTTCAGGAGCAGAGTCCTGGG + Intronic
977302332 4:95282010-95282032 CAGTTGAGAACCACAGGTCTAGG + Intronic
977667032 4:99653863-99653885 CTCTTCAGAGGCAGAGTGCTGGG + Exonic
978937242 4:114392829-114392851 CTGAGGAGAGGCAGAATTCTGGG + Intergenic
983403210 4:167292005-167292027 CTGTTGAGAAACTCAGGTCTAGG - Intergenic
983982036 4:174009601-174009623 CTGATCTGAAGGAGAGTTCTGGG + Intergenic
987299792 5:16587143-16587165 CTTCTGAGAAGAAGAGCTCTTGG + Intronic
987837756 5:23183206-23183228 CTGTTGGGATGTAGACTTCTTGG - Intergenic
988812402 5:34798592-34798614 CTCTTAAGAAGCATAGTTCTTGG + Intronic
988897096 5:35688191-35688213 CTGCTGAAGAGCAGAGTTCCTGG - Intronic
989541421 5:42623247-42623269 CTGTTGAGAAGTTGAGTACAAGG + Intronic
991282687 5:64934249-64934271 CTGTTGGGAAGTGGGGTTCTAGG - Intronic
992223786 5:74598675-74598697 CTTTTTAGAAGCAAAATTCTTGG - Intergenic
992654077 5:78891025-78891047 CTCTTGAGAAGCAGAGTTCATGG - Intronic
995549575 5:113267355-113267377 CTGAAGAGAAGATGAGTTCTAGG - Intronic
998792791 5:145783510-145783532 CTGTTAAAAATCAGAATTCTTGG + Intronic
998985602 5:147752865-147752887 CTGCTGAGATGGGGAGTTCTGGG + Intronic
999263659 5:150252890-150252912 TGGTTAAGAACCAGAGTTCTGGG - Intronic
999543107 5:152596161-152596183 CTGTTGAGATGCAGATTCCTGGG + Intergenic
1001424474 5:171614498-171614520 CTGTTAAAATGCAGAGTTCAGGG - Intergenic
1001639282 5:173233841-173233863 TTGTTGAGGAGCAGAGGCCTGGG - Intronic
1001837857 5:174847063-174847085 AGTTTGAGAAGCACAGTTCTGGG + Intergenic
1001919828 5:175591065-175591087 CTGCTGAGATGCAAAGTCCTTGG + Intergenic
1002053243 5:176583876-176583898 CTTTCTAGAAGCACAGTTCTGGG - Intronic
1004419308 6:15453903-15453925 CTGTTGAGGAGCCAAGATCTGGG + Intronic
1004531722 6:16460665-16460687 CTGTTGGGAAGCATAAGTCTGGG - Intronic
1004558337 6:16721848-16721870 CTTTTGAGAAACAGAATTCTTGG + Intronic
1005358590 6:25008866-25008888 GGGTTGAGAAGCACTGTTCTTGG + Intronic
1008247965 6:49202561-49202583 TTGGTGAGGAGCAGAATTCTAGG + Intergenic
1012448946 6:99334748-99334770 ATTTTGAGCAGCAGCGTTCTTGG - Intronic
1016417199 6:143845272-143845294 GTGTTGGGAAACAGAGTACTGGG + Intronic
1016871885 6:148825903-148825925 ATTATGAGAAGCAGAGTTGTAGG + Intronic
1017219462 6:151949396-151949418 AGGTTGGGAAGCAGAGTGCTGGG - Intronic
1020714807 7:11658674-11658696 CTGTAGATAAGCAGAGTTTCAGG + Intronic
1020813531 7:12875167-12875189 CTCTTTAAGAGCAGAGTTCTGGG - Intergenic
1021149753 7:17135090-17135112 ATGTTTAGAAGCAATGTTCTAGG + Intergenic
1022497681 7:30863271-30863293 CTGGAGAGAAGCAGAGTGGTGGG + Intronic
1022828320 7:34039354-34039376 CAGTTGAGAACTAGAGTACTAGG - Intronic
1022953499 7:35361104-35361126 CTGTTCAGAAGCAGAGAATTAGG + Intergenic
1023054084 7:36278050-36278072 CTGTTAAAATGCAGACTTCTAGG + Intronic
1023284242 7:38602794-38602816 CAGAAGAGAAGCAGTGTTCTTGG - Intronic
1023913026 7:44568808-44568830 GTGGTGAGAAGCAGAGAACTGGG - Intronic
1026427486 7:70311039-70311061 CTATGGAGAGGGAGAGTTCTAGG - Intronic
1026703407 7:72668508-72668530 GTGTTGAGAAGGAGTTTTCTCGG - Intronic
1031919409 7:127589780-127589802 CTCTTTAGAAGCAGGATTCTGGG + Intronic
1037648910 8:20819021-20819043 CTATTGAAAAGCAAATTTCTTGG + Intergenic
1038244244 8:25839804-25839826 CTGATGAGCACCAGTGTTCTGGG - Intergenic
1038458439 8:27694613-27694635 CGGTTGAGAAGCAGAATTAGGGG + Intergenic
1039505192 8:38046956-38046978 CTGCTGGGAGGCAGGGTTCTGGG + Intronic
1040414026 8:47181497-47181519 TCGTGGGGAAGCAGAGTTCTAGG + Intergenic
1043728388 8:83643012-83643034 ATGGTGAGAAGCAGAGATCTGGG - Intergenic
1044018483 8:87074936-87074958 GTGGTTAGAAGCAGAGATCTTGG + Intronic
1044021185 8:87107815-87107837 CTGTTGCCAGGCAGAGTTTTGGG - Intronic
1046339642 8:112836335-112836357 CTGTTGAGAAGAAAAGGTCAAGG - Intronic
1047337823 8:123953353-123953375 GTGTTGAGAAGCAGTGGTCTAGG - Intronic
1048151979 8:131903369-131903391 TTGTTGAAAAGCAGATTCCTAGG - Intergenic
1049412370 8:142478959-142478981 CTGTGGAGAAGCAGAGTGTGGGG + Intronic
1052194034 9:25690501-25690523 GTGTTGAGATGCAGAAGTCTGGG - Intergenic
1052576401 9:30297803-30297825 CTTTTGAGAAACAGAGTTGGAGG + Intergenic
1052819665 9:33128817-33128839 CTGGGGAGAAGCAGACTCCTGGG - Intronic
1056078367 9:83063352-83063374 CTGTGGAGAAGCGGAGCGCTGGG - Intergenic
1057456096 9:95212932-95212954 GTGTTGGGAAGCACAGCTCTAGG - Intronic
1057927521 9:99166396-99166418 CCCTTGAGAAGGAAAGTTCTTGG + Intergenic
1058596731 9:106623051-106623073 CAGGTGACAAGCAGTGTTCTAGG - Intergenic
1060566831 9:124600210-124600232 CAGATGAGAACCAGAGATCTTGG - Intronic
1187358387 X:18600620-18600642 CACTTGAGAGACAGAGTTCTTGG + Intronic
1187380384 X:18796255-18796277 AAGTTGAAAACCAGAGTTCTGGG - Intronic
1187902153 X:24035282-24035304 CAGTTGGGGAGCAGGGTTCTGGG - Intergenic
1189589694 X:42497949-42497971 CTCTTGAGAAGCAGGAGTCTGGG + Intergenic
1192402809 X:70853938-70853960 CTGGACAGAAACAGAGTTCTAGG + Intronic
1195993128 X:110703059-110703081 ATTTTGAGAAGCAGTGGTCTAGG - Intronic
1197287707 X:124615029-124615051 CTGTTGAGAAGATGGCTTCTAGG - Intronic
1200811950 Y:7494979-7495001 TTGTTGAAAATCAGAGTTTTTGG + Intergenic